We narrowed to 9,471 results for: BLI
-
Plasmid#52502Purposeexpresses human FbxO11-ΔFbox in mammalian cells with FLAG-HA tag at N-terminusDepositorInsertFbxO11 (FBXO11 Human)
TagsFLAG-HAExpressionMammalianMutationdeletion of Fbox (deleted aa 71-116)PromoterCMVAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF RBP-FL P53
Plasmid#174042PurposeExpress Full length P53 in E.coli with cleavable expression/purification tag (ribose binding protein)DepositorInsertP53 gene (TP53 Human)
TagsThermoanaerobacter Tencongenesis ribose binding p…ExpressionBacterialPromoterT7Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
BICstim-Gag-dCAS9-VPR
Plasmid#120922Purposeencodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation.DepositorInsertGAG (FMLV)-dCAS9-VPR
TagsnoneExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG
Plasmid#218159PurposeThis plasmid harbors the base editor SCBE3-NG along with an sgRNA cloning cassette, facilitating cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / L1111…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
NanoBRET BiBRET Vector, NanoLuc-HRAS WT-CRAF RBD-HaloTag
Plasmid#236861PurposeExpress NanoLuc(R)-HRAS WT-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-HRAS WT-BRAF RBD-NanoLuc
Plasmid#236850PurposeExpress HaloTag(R)-HRAS WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
BII-BCA-Prom-ASCL2
Plasmid#133394PurposePiggybac vector for heterologous promoter reporter assay of human ASCL2 promoterDepositorInsertdestabilized tdTomato-NLS and destabilized NLS-GFP
ExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free) drives expressi…Available SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SSpB-HaloTag-p63DH
Plasmid#176116PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SSpB-mCherry-p63DH
Plasmid#176112PurposeHeterodimerization with iLID, RhoA activationDepositorInsertRHOGEF p63 (ARHGEF25 Human)
ExpressionMammalianAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-RRBP1-WPRE-UbC-Emerald
Plasmid#225942PurposeLentiviral vector plasmid expressing human ribosome binding protein 1 (RRBP1) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-S1977P
Plasmid#64876Purposelentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationS1977P, mimicking the chaos1 mutationPromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO11-Jeff-pcDNA3.1-
Plasmid#52503Purposeexpresses human FbxO11-Jeff mutant in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-ePOUSKM
Plasmid#206398PurposeExpresses four genes (human ePOU, SOX2, KLF4, c-MYC) in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE MD-deltaN-ER
Plasmid#13496DepositorInsertMyoD1-Estrogen Receptor Fusion Protein (Myod1 Human, Mouse)
UseRetroviralExpressionMammalianMutationMyoD (containing a deletion in aa3-56) was fused …Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/S647A
Plasmid#74938PurposeMammalian expression of human NSF mutant S647A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationS647A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-CYBC1:CYBB-SmBiT BiBiT Vector(CMV)
Plasmid#237084PurposeExpress LgBiT-CYBC1:CYBB-SmBiT Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsLgBiT and SmBiTExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET PD-1/SHP2 Bidirectional Vector
Plasmid#237016PurposeExpress NanoLuc(R)-PD1/SHP2-HaloTag Fusion Proteins in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector, NanoLuc-NRAS (Q61K)-CRAF RBD-HaloTag
Plasmid#236860PurposeExpress NanoLuc(R)-NRAS (Q61K)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61KPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoLuc-NRAS (Q61R)-CRAF RBD-HaloTag BiBRET Vector
Plasmid#236862PurposeExpress NanoLuc(R)-NRAS (Q61R)-CRAF RBD-HaloTag(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector HaloTag-NRAS WT-BRAF RBD-NanoLuc
Plasmid#236851PurposeExpress HaloTag(R)-NRAS WT-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
BiBRET Vector HaloTag-NRAS (Q61R)-BRAF RBD-NanoLuc
Plasmid#236852PurposeExpress HaloTag(R)-NRAS (Q61R)-BRAF RBD-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationQ61RPromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV 9P31-hSyn-Venus-P2A-Tau-RING I18R/M72E
Plasmid#233694PurposeAAV expression of Venus-P2A-Tau-RING-I18R/M72E from hSyn promoterDepositorInsertVenus-P2A-Tau-RING I18R-M72E
UseAAVExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 C100A-WPRE-UbC-Emerald
Plasmid#225949PurposeLentiviral vector plasmid expressing human CKAP4 mutation C100A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationC100APromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 CC-WPRE-UbC-Emerald
Plasmid#225950PurposeLentiviral vector plasmid expressing human CKAP4 mutation double cysteine (CC) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationAdditional cysteine inserted after Cys-100PromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(1-131)-WPRE-UbC-Emerald
Plasmid#225955PurposeLentiviral vector plasmid expressing human CKAP4 mutant lacking the luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationTruncated CKAP4 (1-131) lacking the luminal domainPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RTN4-WPRE-UbC-Emerald
Plasmid#225938PurposeLentiviral vector plasmid expressing human reticulon 4 (RTN4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM2-WPRE-UbC-Emerald
Plasmid#225940PurposeLentiviral vector plasmid expressing human stromal interaction molecule 2 (STIM2) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianPromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1
Plasmid#218156PurposeThis plasmid harbors the base editor SCBE3-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF1-Hypa
Plasmid#218158PurposeThis plasmid harbors the base editor SCBE3-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-Hypa
Plasmid#218157PurposeThis plasmid harbors the base editor SCBE3-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing in Streptomyces.DepositorInsertsscbe3-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Creb5 shRNA
Plasmid#195020PurposeBovine Creb5 shRNA targeting the Creb5 3′UTRDepositorInsertCreb5 shRNA (CREB5 Bovine)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
GAL4-Creb5 (1- 128) T59/T61 A
Plasmid#195032PurposeGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with T59/T61 A mutation)DepositorInsertGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with with T59/T61 A mutation) (CREB5 Bovine)
ExpressionMammalianMutationT59/T61 AAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
GAL4-Creb5 (1- 128) C18/C23 S
Plasmid#195033PurposeGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with C18/C23 S mutation)DepositorInsertGAL4-Creb5 fusion construct (N-terminus of Creb5,128aa, with C18/C23 S mutation) (CREB5 Bovine)
ExpressionMammalianMutationC18/C23 SAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Bn R52A, R54A pMT2
Plasmid#206087PurposeCav2.2 N-terminus (amino acids 1-95) with R52A and R54A mutations that prevent dominant-negative suppression of Cav2.2 currents by truncated Cav2.2DepositorAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_gRNA_3418711_KCNB2
Plasmid#197558PurposegRNA targeting upstream region of KCNB2 (site 3418711, control for epigenetic targeting)DepositorInsertupstream KCNB2 promoter gRNA (Kcnb2 Rat)
UseGrna with puromycin selectionTagspuromycin resistance cassette under CMV promotionExpressionMammalianPromoterU6Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_SMAD-FOS_Mutant
Plasmid#194188PurposeIncludes the promoter (1kb) of SMTS with mutated SMAD/FOS binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated SMAD/FOS Site, Region 3-15nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_STAT1-2_Mutant
Plasmid#194189PurposeIncludes the promoter (1kb) of SMTS with mutated STAT1/2 binding siteDepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated STAT1/2 site, Region 653-673nt of 1000ntPromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only