We narrowed to 786 results for: 1182
-
Plasmid#1182DepositorAvailable SinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only
These results may also be relevant.
-
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable SinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5L(M55V)-SBP-mCitrine
Plasmid#209846PurposeSynchronize trafficking of Stx5L (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertSTX5 (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5S-SBP-mCitrine
Plasmid#154845PurposeSynchronize trafficking of Stx5S from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Short isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationLacks amino acids 1-54, enocdes short isoform of …PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
makeTCR_Hs.TRAV41
Plasmid#233981PurposeHs TRAV gene for makeTCR assemblyDepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWB14-LYX078
Plasmid#126296PurposeWith a Nicotiana benthamiana transcription factor in PGWB14 backbone, for Agrobacterium mediated transient or stable expression corresponding transcription factor fused with a C-terminal HA tag.DepositorInsertNiben101Scf11823g00016.1
TagsHAExpressionPlantPromoterCaMV 35SAvailable SinceJune 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
TP53I3
Plasmid#38849PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X31
Plasmid#59255PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt80-ex5-7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pStA1BZ
Plasmid#114164PurposeStart-Stop Assembly Level 1BZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1BC
Plasmid#114165PurposeStart-Stop Assembly Level 1BC plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1CZ
Plasmid#114166PurposeStart-Stop Assembly Level 1CZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA212
Plasmid#114171PurposeStart-Stop Assembly Level 212 plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pStA1DZ
Plasmid#114168PurposeStart-Stop Assembly Level 1DZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1DE
Plasmid#114169PurposeStart-Stop Assembly Level 1DE plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA1EZ
Plasmid#114170PurposeStart-Stop Assembly Level 1EZ plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pStA223
Plasmid#114172PurposeStart-Stop Assembly Level 223 plasmidDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only