We narrowed to 2,228 results for: Xpa
-
Plasmid#228218PurposeExpress wild type AlkB protein in E. coli BL21(DE3)DepositorInsertAlpha-ketoglutarate-dependent Dioxygenase (alkB Synthetic)
TagsHis tagExpressionBacterialMutationcodon optimizedPromoterT7Available sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP.R270
Plasmid#138219PurposeExpresses the split mCherry reporter interrupted by the IMPDH-1 intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFP.R272
Plasmid#138221PurposeExpresses the split mCherry reporter interrupted by the SspGyrB artificially mini-intein (in cis)DepositorInsertsUseSynthetic BiologyTags6xHisExpressionBacterialPromoterP(araBAD) and iPCAvailable sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Tight-Puro_Myt1
Plasmid#64845PurposeA lentiviral vector for the expression of mouse Myt1 under doxycyline controlDepositorAvailable sinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMK467 (dTAG-BromoTag-mAID-EGFP)
Plasmid#214393PurposedTAG-BromoTag-mAID-EGFP reporter (TOL2)DepositorInsertdTAG-BromoTag-mAID-EGFP reporter
ExpressionMammalianAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hTGM1-Flag
Plasmid#180406Purposelentiviral transduction of human TGM1 (with a C-terminal Flag tag) geneDepositorAvailable sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
ND4.2-Left TALE-G1397-N-dead-mCherry
Plasmid#179683PurposeExpression of base editor in mammalian cells and for cell sortingDepositorInsertCOX8a MTS_3xFLAG_ND4.2 Left TALE_2aa_DddA G1397-N (E1347A)_1xUGI_P2A_mCherry_ATP5B 3'UTR
ExpressionMammalianMutationE1347AAvailable sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GR-ICUE2
Plasmid#173017PurposeImproved green-red FRET based cAMP indicator.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGR-ICUE2
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable sinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJW1595
Plasmid#121062PurposemKate2^SEC^BioTag::AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertmKate2^SEC^BioTag::AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, Biotin acceptor peptide (BioTag), C. eleg…ExpressionWormAvailable sinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NLB (N2NL-FL)-ires-EGFP
Plasmid#122954PurposeLentiviral expression of NOTCH2NLB full length under CAG promoter with EGFP expressionDepositorAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MtAcKRS (human-opti)
Plasmid#164195PurposeTo express a Methanosarcina thermophila derived AcKRS in mammalian cells for genetic code expansionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMtAcKRS-478(human-opti)
UseSynthetic BiologyExpressionMammalianMutationD76G; L325M; L329I; Y330F; L333A; C372FPromoterCMVAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-RUNX2-IDR-mCherry-CRY2-NLS
Plasmid#145267PurposeMammalian Expression of Nuclear Opto RUNX2 IDR with SV40 NLSDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRUNX2wt-IDR (RUNX2 Human)
ExpressionMammalianAvailable sinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT271.359
Plasmid#127845Purposeclone A3A CBEs by SapI Golden GateDepositorInsertA3A
Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available sinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pEC2935 (p7INT-P23_mNeongreen~ssrA (LDD variant))
Plasmid#218508Purposeintegrative plasmid enabling constitutive expression of a destabilized mNeongreen reporter in Streptococcus pyogenes, targets the attP site of phage T12 in several S. pyogenes strains via an integraseDepositorInsertmNeongreen
Tagsmodified ssrA degradation tagExpressionBacterialMutationdeletion of MCS containing Plac_lacZa, introducti…PromoterP23Available sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pH1v1
Plasmid#60244PurposegRNA expression by the H1 promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 promoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB2194
Plasmid#67545PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked hphMX marker, integration into S. cerevisiae X-4 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2195
Plasmid#67548PurposeEasyClone system-based yeast integrative vector carrying loxP-flanked hphMX marker, integration into S. cerevisiae XI-3 chromosomal location, USER site for cloning, amp resistanceDepositorTypeEmpty backboneUseCre/Lox; IntegrativeExpressionYeastAvailable sinceMarch 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYSD085
Plasmid#212922PurposeEncodes the HA-tagged 649 Stalk yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsert649 Stalk
ExpressionBacterialAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only