We narrowed to 14,241 results for: Cas9
-
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP002
Plasmid#103872PurposeBroad-host-range Cas9/gRNA co-expression backbone plasmid (no gRNA)DepositorInsertshph
Spcas9 D147Y P411T
UseCRISPRTagsNLSExpressionYeastMutationD147Y P411TPromoterArxula adeninivorans TEF1 and Ashbya gossypii (Er…Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP025
Plasmid#103874PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces lactisDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces lactis
UseCRISPRExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 5' Npm1 gRNA
Plasmid#127900PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NM-01
Plasmid#69799PurposeBacterial expression of Cas9 with His, MBP, and Strep tagsDepositorInsertCas9
TagsHIS, MBP, and StrepIIExpressionBacterialMutationAspartate 10 to Alanine (D10A) and Histidine 840 …Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXZ13lacZalphaKanR
Plasmid#160230PurposeLike pXZ13lacZalpha, but adds second level of selection with Kanamycin resistance.DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterlacAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
UC16m
Plasmid#121038PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertgQi Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC17m
Plasmid#121039PurposeMoClo golden gate assembly DE part for gV1 gRNA (guide RNA for S. pyogenes Cas9; sequence from doi: [10.15252/msb.20145735]). Please see Supplemental Documents for annotated Genbank file.DepositorInsertgV1 Cas9 gRNA UC part
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C114m
Plasmid#121013PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9, with bbsI cut sites removed synonymously). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9 with no bbsI or BsaI sites
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2
Plasmid#52961PurposeReplaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only