We narrowed to 5,792 results for: actin
-
Plasmid#24503DepositorInsertRASSL Ro2 (OPRK1 Human)
TagsFLAG and NLS from prolactinExpressionMammalianMutationmutations in extracellular loops 2 (see comments …Available sinceJune 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIPK3[S199D][S227D]-FLAG
Plasmid#199324Purposedouble mutated phosphorylation site (kinase acitivity and MLKL interaction active)DepositorInsertReceptor-interacting serine/threonine-protein kinase 3 (RIPK3 Human)
TagsFLAGExpressionMammalianMutationchanged Serine 199 and 227 to Aspartic AcidAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL1P3 ZmUbiP:GRF-GIF:NosT
Plasmid#198047PurposeMoClo Golden Gate Level 1 Position 3. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.InsertZmUbiP::TaGRF4-GIF1::NosT
UseSynthetic BiologyPromoterZea mays (maize) ubiquitin promoterAvailable sinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 (RIPK2A-c036)
Plasmid#110268PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
GST-PBD H538A/K540M
Plasmid#60879PurposeBacterially expressed GST-tagged human polo-like kinase 1 PBD AA 365-653 H538A/K540M mutantDepositorAvailable sinceNov. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7WT-VA
Plasmid#115182PurposeLentiviral transduction and expression of PARK7WT into any mammalian cellDepositorInsertPARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3 FLAG_CMV14/OCTN2 (wt)
Plasmid#112799PurposeExpression of OCTN2DepositorAvailable sinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-P41nmt1-mEGFP
Plasmid#105140PurposeYeast gene targetingDepositorInsertkanMX6-P41nmt1-mEGFP
Tags41nmt1-mEGFPExpressionBacterial and YeastMutationA206KPromoter41nmt1Available sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQE9-His-p97deltaD2(K251A)
Plasmid#17230DepositorInsertp97 (Vcp Mouse)
TagsHisExpressionBacterialMutationchange codon 457 to stop codon, change lysine 25…Available sinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IPU-GFP-NEK9W967A
Plasmid#168271PurposeExpresses LIR (LC3-interacting region) mutant NEK9DepositorAvailable sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/MALAT1[WT] (pAVA3171)
Plasmid#239347PurposeExpresses full-length, driven by its own promoter MALAT1 with wild-type ENE and an 11-nt insertion (cgctcgacgta).DepositorInsert10,843 bp of MALAT1 of genomic locus amplified from genomic DNA of Hela cells (MALAT1 Human)
ExpressionMammalianMutationAn 11-nt insertion (cgctcgacgta)Available sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-TA Bik-IRES-Puromycin
Plasmid#133026PurposeExpresses EGFP-tagged tail anchor sequence of BikDepositorInsertBcl-2-interacting killer (BIK Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdeleted amino acids 1-110PromoterHuman elongation factor 1 alphaAvailable sinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-TetR
Plasmid#103798PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Venus-Bik-4E-pEGFP-C1
Plasmid#166744PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, Bik with mutation in BH3 domain to disrupt binding anti-apoptotic proteinsDepositorInsertBik-4E (BIK Human)
TagsVenusExpressionMammalianMutation4 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIS1-mutant RhoA 3'UTR
Plasmid#26090DepositorInsertmutant RhoA 3'UTR (RHOA Human)
UseLuciferaseExpressionMammalianMutationBoth miR-31 binding sites in 3’ UTR mutagenized. …Available sinceOct. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
Venus-tBid-4E-pEGFP-C1
Plasmid#166743PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, tBid with mutation in BH3 domain to disrupt binding anti-apoptotic proteinsDepositorInserttBid-4E (Bid Mouse)
TagsVenusExpressionMammalianMutation4 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable sinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hNCL
Plasmid#103806PurposeBLInCR 'Localizer' construct that marks the nucleoli and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhNCL: A395G (K132R), A421G (K141E), A424G (K142E)…PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hNCL
Plasmid#103805PurposeBLInCR 'Localizer' construct that marks the nucleoli and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhNCL: A395G (K132R), A421G (K141E), A424G (K142E)…PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only