We narrowed to 25,317 results for: Spr
-
Plasmid#48219PurposedCas9VP64 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP64 activation domain
UseCRISPR; Gateway donorTagsHA Tag and VP64MutationD10A;H840AAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pVC297 VEGF Site#1
Plasmid#47505Purposehuman gRNA expression vector targeting VEGFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
STK17A gRNA (BRDN0001149480)
Plasmid#77916Purpose3rd generation lentiviral gRNA plasmid targeting human STK17ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK17B gRNA (BRDN0001146764)
Plasmid#76798Purpose3rd generation lentiviral gRNA plasmid targeting human STK17BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146792)
Plasmid#77948Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001146747)
Plasmid#77949Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN3 gRNA (BRDN0001487150)
Plasmid#77950Purpose3rd generation lentiviral gRNA plasmid targeting human PKN3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHS1232
Plasmid#205969PurposeMWEE01000013 Cas5-HNH operon (E. coli codon optimized) + CRISPR array in pACYCDuet-1 Lac promotersDepositorInsertCas5-HNH proteins and CRISPR array
ExpressionBacterialPromoterLac (proteins), pJ23119 (crRNA)Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVC228 VEGF Site#3
Plasmid#47507Purposehuman gRNA expression vector targeting VEGFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_5
Plasmid#74181Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-Cas9
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001147800)
Plasmid#76349Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_PSMD1_sgRNA_1
Plasmid#74180Purposelentiviral vector expressing sgRNA targeting PSMD1DepositorInsertPSMD1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIM27 gRNA (BRDN0001145893)
Plasmid#77516Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM27DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSL0747 (pDonor_L-MmeI)
Plasmid#130647PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene. The mutated left end introduces an MmeI recognition site (used for Tn-seq). Total transposon size = 977 bp.DepositorInsertVchCAST donor DNA (L*)
UseCRISPR; TransposonExpressionBacterialMutationTGTTGATG --> TGTTGGAGAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
Plasmid#140202PurposeCRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.DepositorInsertmCherry
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only