We narrowed to 8,394 results for: Dos;
-
Plasmid#172746PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-16; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-16
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
Str-Endo-KKXX_SBP-EGFP-LIMP2
Plasmid#222323PurposeSynchronize the trafficking of LIMP2 from the ER.DepositorInsertStreptavidin-KDEL and LIMP2 fused to SBP-EGFP (SCARB2 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T_mouseH3.1-HaloTag
Plasmid#244242PurposeCRISPR/Cas9 donor plasmid to tag mouse histone H3.1 with Halo tagDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
138-dCas9-Dnmt3a
Plasmid#84570PurposePiggyBac transposon system construct with dCas9-Dnmt3aDepositorInsertdCas9-Dnmt3a (DNMT3A Synthetic, Human)
ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 E-cadherin shRNA/mE-cadherin-mCherry
Plasmid#101282PurposeLentiviral expression of shRNA and mouse E-cadherin -mCherryDepositorInsertE-cadherin
UseLentiviralTagsmCherryExpressionMammalianAvailable SinceJan. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 E-cadherin shRNA/Ecad-tdTomato
Plasmid#101278PurposeLentiviral expression of shRNA targeting Ecad and Ecad-tdtomatoDepositorInsertE-cadherin
UseLentiviralTagstdtomatoExpressionMammalianAvailable SinceJan. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
cyto-YFP-FKBPx5
Plasmid#103777Purposeexpression of iPOLYMER component in mammalian cells; has nuclear exclusion sequenceDepositorInsertcyto-YFP-FKBPx5
ExpressionMammalianPromoterCMVAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
FZ-NbPDS
Plasmid#184268PurposepAIDE containing a full-length CPSMV RNA2 cDNA modified to accomodate an NbPDS fragment.DepositorInsertCPSMV RNA2 cDNA, modified to permit foreign gene insertion between MP and L-CP
ExpressionPlantMutationThe protease processing site between MP and L-CP …PromoterCaMV 35S with duplicated enhancerAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-16-3xFLAG-LaG-2
Plasmid#172765PurposeBacterial expression of dimerized anti-GFP nanobodies LaG-16 and LaG-2 (3xFLAG linker)DepositorInsertLaG-16-3xFLAG-LaG-2
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH4783
Plasmid#200785PurposePnpr-4 snb-1::pHluorin unc-54 3' UTR C.elegans AVA and other neurons expression of snb pHluorinDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pICE-FLAG-NAT10-siR-G641E
Plasmid#59366PurposePlasmid for constitutive or doxycycline-inducible expression of G641E mutant of human NAT10 resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertNAT10 NM_024662 (NAT10 Human)
TagsFLAGExpressionMammalianMutationG641E and silent mutations to render the cDNA res…PromoterCMV-tetAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pY026
Plasmid#84741PurposeExpresses huAsCpf1 and crRNA guideDepositorInserthuAsCpf1
Tags3xHA and NLSExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
Gβ-2A-cpV-Gγ2-IRES-Gαi2-mTq2
Plasmid#69624PurposeA FRET sensor for Galphai2 activation, encoded on a single plasmid.DepositorInsertsGbeta-2A-cpV-Ggamma2
Galphai2-mTurquoise2
Tagsciruclar permutated Venus (cp173V) and mTurquoise…ExpressionMammalianPromoterCMV and CMV (IRES)Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSET mNG-GECO1
Plasmid#201933PurposeExpresses mNG-GECO1 indicator in bacteriaDepositorInsertmNeonGreenGECO1
TagsHIS tagExpressionBacterialAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG_V5-PPP6C
Plasmid#92013PurposeExpresses V5-PPP6C, includes IRES-EmeraldDepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBbi G418 Hu Her2
Plasmid#183246PurposeExpression of human HER2 antigen in a Sleeping Beauty transposon vectorDepositorInsertHer2 (ERBB2 Human)
ExpressionMammalianAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-6
Plasmid#172771PurposeBacterial expression of anti-mCherry nanobody LaM-6, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-6
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gβ-2A-cpV-Gγ2-IRES-Gαi1-mTq2
Plasmid#69623PurposeA FRET sensor for Galphai1 activation, encoded on a single plasmid.DepositorInsertsGbeta-2A-cpV-Ggamma2
Galphai-mTurquoise2
Tagsciruclar permutated Venus (cp173V) and mTurquoise…ExpressionMammalianPromoterCMV and CMV (IRES)Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only