We narrowed to 9,308 results for: control
-
Plasmid#129280PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHΔPPPLDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationthe last 4 amino acids (PPPL) of the KASH domain …PromoterCMVAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ER-mRFP
Plasmid#231176PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with mRFP, in mammalian cellsDepositorInsertER-mRFP
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
DRH002_scAAV-hSyn-delta_iCre-HA
Plasmid#225087PurposeExpression of inactive delta-iCre (control) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertdelta_iCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv1(mCherry-FLAG) in pTwist-CMV
Plasmid#216165PurposeExpression of mCherry specifically in cells with TDP-43 knockdown. Uses AARS1-derived cryptic exon to control mCherry expression. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertmCherry with C-terminal FLAG tag
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBFC0619
Plasmid#186690PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_2xBsaI_NT (Guide Stuffer) crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5(TA)-ires-puro
Plasmid#167823Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pBG-mCRE98-NLS-EGFP-WPRE
Plasmid#239977Purposeadeno-associated virus (AAV) encoding enhanced green fluorescent protein (eGFP) under motor neuron-selective control of minimal beta globin promoter (pBG) and CRE98DepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBFC0996
Plasmid#186695PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, 2xLguI cargo stuffer, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
crRNA
Tn7 transposon
2xLguI Cargo Stuffer
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
Plasmid#199551PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterEf1aAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBFC0625
Plasmid#186691PurposeVcDART under control of Lac promoter, Vc_lacZ_α_1 gRNA, GmR+sfGFP cargoDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_lacZ_α_1 Spacer crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TdLanYFP-AURKA-Aquamarine
Plasmid#228562PurposeEncodes the AURKA biosensor where LC3B is flanked by the Aquamarine/TdLanYFP donor/acceptor FRET pair and under the control of the CMV promoter.DepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBFC0687
Plasmid#186692PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_2xBsaI_NT (Guide Stuffer) gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_CRFmut
Plasmid#208659PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) control sensor GRAB_CRFmut in neuronsDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut
UseAAVPromoterhSynAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DIO-GRAB_CRFmut
Plasmid#208663PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) control sensor GRAB_CRFmut in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut
UseAAVPromoterEFSAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_FLAG-Mkk7-JNK2-P2A-Hygro_Barcode
Plasmid#170228PurposeBarcoded lentiviral vector to express Mkk7-JNK2 fusion in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorUseLentiviralTagsFLAGMutationFusionPromoterEF1aAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-FF
Plasmid#85486PurposeFirefly luciferase under the control of ATP5O 5'UTRDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F2-empty vector
Plasmid#125552PurposeN2H assay vector with nanoluc fragment2 (empty control, no Gateway cloning site, expressing nanoluc fragment2)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBFC0694
Plasmid#186693PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_lacZ_α_1 gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_lacZ_α_1 gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Ubc-rtTA-I2G
Plasmid#70076Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSilent mutations are introduced to escape from RN…PromoterTet responsible promoterAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F1-empty vector
Plasmid#125551PurposeN2H assay vector with nanoluc fragment1 (empty control, no Gateway cloning site, expressing nanoluc fragment1)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5(TA) + PGK-puro
Plasmid#167819Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLINC-AKAR1(TA)-CAAX
Plasmid#87706PurposeNegative-control mutant of FLINC-AKAR1-CAAX.DepositorInsertFLINC-AKAR1(TA)-CAAX
Tags6xHis, C-terminal targeting sequence from Kras, T…ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP_AAVS1
Plasmid#141211PurposepDECKO_GFP_AAVS1_1801. Targeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_AAVS1_1801
Plasmid#159090Purposetargeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4(TA) + PGK-blast
Plasmid#167827PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Y102A-Ubc-rtTA-I2G
Plasmid#70075Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 (RRM mutant) in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationY102A. Silent mutations are introduced to escape …PromoterTet responsible promoterAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-EF1α-Luc-C20orf24-3’UTR-WT
Plasmid#128551PurposeLentiviral constitutive expression of Firefly luciferase under control of WT 3'UTR of human C20orf24.DepositorInsertFirefly luciferase
UseLentiviral and LuciferaseExpressionMammalianPromoterEF1aAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5(TA) + PGK-blast
Plasmid#167820Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-SL-FF
Plasmid#85491PurposeFirefly luciferase under the control of ATP5O 5'UTR followed by a stem-loopDepositorInsert5'UTR of ATP5O followed by stem loop (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-puro
Plasmid#167830PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN4(TA) + PGK-puro
Plasmid#167826PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only