We narrowed to 9,812 results for: Met;
-
Plasmid#174638PurposeRapalog-inducible coupling to dimeric moss kinesin-14 for retrograde transport via FRBDepositorInsertFRB-GFP-ppKin14VIb(861-1321)
TagsFRB-GFPExpressionMammalianMutationEGFP: Met1Del; ppKin14VIb(aa861-1321)PromoterChicken beta-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Synthetic, Mouse)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus-BimEL-pEGFP-C1
Plasmid#166735PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, BimELDepositorAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K49R-STAT3
Plasmid#123166PurposeExpresses K49R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK49R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K140R-STAT3
Plasmid#123168PurposeExpresses K140R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK140R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT-TO-FH-Nsp7-Nsp8_GC3opt
Plasmid#157692Purposemammalian expression of N-terminally Flag-His8 tagged Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorInsertFH-Nsp7-Nsp8_GC3opt (ORF1ab SARS-CoV-2)
TagsFlag-His8ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
Tags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-HA-Suv4-20h2mut
Plasmid#86692PurposeFor transcription of of Suv4-20h2mut mRNA preceded by an HA-tag in 5'DepositorInserthistone-lysine N-methyltransferase KMT5C mutant (Kmt5c Mouse)
TagsHAMutationMutated asparagine 273 to cysteine 276 (NHDC) int…PromoterT3Available SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SLC30A10-D248A
Plasmid#82346PurposeExpresses FLAG-tagged SLC30A10-D248A in mammalian cellsDepositorAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SLC30A10-N43H
Plasmid#82344PurposeExpresses FLAG-tagged SLC30A10-N43H in mammalian cellsDepositorAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-3xHA-NHL only-LIN-41
Plasmid#52723Purposeretroviral expression of human LIN-41 / TRIM71 containing only the NHL repeats and 3 N-terminal HA tagsDepositorInsertLIN-41 (TRIM71 Human)
UseRetroviralTags3xHAExpressionMammalianMutationNHL-only contains only an initiating methionine a…Available SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH104
Plasmid#48262PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae TEF1 promoter in yeast.DepositorInsertsTEF1p 5' fragment
URA3 5' fragment
TEF1p 3' fragment
UseRoutine cloning vectorMutationFrom SK1 background. -343 to -1 relative to TEF1 …PromoterTEF1pAvailable SinceFeb. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-cpVenus-FLARE-AKAR
Plasmid#123329PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
WT N-His Ana GvpC in pET28a
Plasmid#153294PurposeExpresses N-terminal His-tagged GvpC from Anabaena flos-aquae in E.coliDepositorInsertGas vesicle protein C (N-terminal his-tagged)
TagsHis-tagExpressionBacterialMutationAdded a hexahistidine tag after the methionine at…PromoterT7Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K49R-STAT3
Plasmid#123167PurposeExpresses K49R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK49R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K140R-STAT3
Plasmid#123169PurposeExpresses K140R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK140R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K685R-STAT3
Plasmid#123171PurposeExpresses K695R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK685R substitutionAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp7-Nsp8-HF_GC3opt
Plasmid#157693Purposemammalian expression of C-terminally His8-Flag tagged Nsp7-Nsp8 fusion protein under control of a tetracycline-inducible promoterDepositorInsertNsp7-Nsp8-HF_GC3opt (ORF1ab SARS-CoV-2)
TagsHis8-FlagExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-Venus-cpVenus-FLARE-CKAR
Plasmid#123343PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.DepositorInsertVenus-cpVenus-FLARE-CKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, Xpress (TM…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only