We narrowed to 19,571 results for: INO
-
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH029
Plasmid#171060PurposePlasmid for expressing Gag fused to spyCas9-3x FLAG-2x SV40 NLS with the SQNYPIVQ HIV-1 cleavage site in betweenDepositorInsertGag-spyCas9
UseCRISPR and LentiviralTags2x SV40 NLS and 3x FLAG tagExpressionMammalianPromoterCAGAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
FUGW-ER-TurboID
Plasmid#200965Purpose3rd gen lentiviral plasmid for expressing endoplasmic reticulum localized TurboID with EGFPDepositorInsertER-TurboID
UseLentiviralTagsEGFPExpressionMammalianAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IPU-FLAG-NEK9
Plasmid#168269PurposeExpresses NEK9 in mammalian cellsDepositorAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIIS928
Plasmid#238211PurposeExpresses TaTasR with an N-terminal HA-NLS tag under CMV promoter in human cells.DepositorInsertTaTasR
TagsHA-NLSExpressionMammalianAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMIIS1011
Plasmid#238212PurposeExpresses ParTasR with an N-terminal HA-NLS tag under CMV promoter in human cells.DepositorInsertParTasR
TagsHA-NLSExpressionMammalianAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTYF-super-mfSERT-1.9k-Venus-WPRE
Plasmid#156394PurposeExpresses Venus under SERT gene promoterDepositorInsertsVenus
Gal4p65
UseLentiviralAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLS-SceI
Plasmid#137725PurposeLentivirus reporter assay plasmid that contains a I-SceI site and a EGFP reporter gene.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLS-SV40-mP-EGFP
Plasmid#137724PurposeLentivirus based EGFP expression vectorDepositorInsertSV40 enhancer
UseLentiviralExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSH824-ssr
Plasmid#198027PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Apr resistance cassette
ExpressionBacterialPromoterAprR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSH424-ssr
Plasmid#198026PurposeExpresses the gene codying for the Ssr recombinase from Pseudomonas putida DOT-T1EDepositorInsertT0 terminator - Sm resistance cassette
ExpressionBacterialPromoterSmR promoterAvailable SinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1362 scFv entry plasmid
Plasmid#201912PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)DepositorInsertStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1180 U6-reci Gag-pol v2
Plasmid#201915PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-pol
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMK381 (AAVS1 CMV-OsTIR1F74G)
Plasmid#140536PurposeAAVS1 CMV-OsTIR1(F74G)DepositorInsertCMV-OsTIR1(F74G)
ExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEA038
Plasmid#224547PurposeBlast-T2A-2xHA-FKPB12(dTagDegron) mouse Nipbl N-term targeting vectorDepositorInsertFKBP12F36V degron (dTAG system), blasticidin, 2xHA tag
UseMouse TargetingAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGFP-NT1
Plasmid#46914PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)DepositorInsertsgGFP-NT1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pXR002: EF1a-dCasRx-2A-EGFP
Plasmid#109050PurposeCatalytically inactive dCasRx with 2A-EGFPDepositorInsertdCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianMutationR239A/H244A/R858A/H863AAvailable SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-LAMP1-RFP-3xHA
Plasmid#102932PurposeLentiviral expression of a lysosomal tag (LAMP1-mRFP1-HA)DepositorInsertLAMP1
UseLentiviralTagsRFP-HAPromoterubcAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only