We narrowed to 872 results for: Anti-CRISPR
-
Plasmid#162077Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable mKate2 reporter and puromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pSCAR_sgRNA_hygro-tagBFP-lox2272
Plasmid#162078Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and hygromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_blast-tagBFP-lox5171
Plasmid#162072Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and blasticidin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_blast-tagBFP-lox2272
Plasmid#162071Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and blasticidin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterU6, EF1aAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
AWP-029
Plasmid#213966PurposeExpresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for gRNA constitutive expression.DepositorInsertCas12a (cas12a Segatella bryantii, Synthetic)
Tags3XFLAGExpressionBacterialMutationD875A to inactivate target nuclease activityPromoterPcfxA, IPTG inducibleAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CDS12_Cas9-NLS
Plasmid#136122PurposePuchta Arabidopsis codon-optimised Cas9 for CRISPR. CDS12 for N-term fusion with a CTAGDepositorInsertCDS12_AtcoCas9-NLS(noStop)
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
PX458-gR2A_ISO
Plasmid#124808PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a> plasmids to convert expression of rat IgG2a hybridomas to isotype of choice.DepositorInserthSPCas9
Tags3XFLAG and GFPExpressionMammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dpcoCas9-SunTag
Plasmid#158410PurposeCRISPR-dpcoCas9 fused with SunTag recruiting VP64 activators for transcriptional activationDepositorInsertdpcoCas9-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-VP64-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMpGWBhis03-Citrine
Plasmid#188557PurposeBinary vector for the expression of Citrine with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine and MpIGPDm
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR082
Plasmid#188551PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR082
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR085
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGWBhis03-Citrine-NLS
Plasmid#188558PurposeBinary vector for the expression of Citrine-NLS with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine-NLS and MpIGPDm
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-VP64_Blast
Plasmid#192655Purpose3rd generation lenti vector encoding scFv-VP64 with 2A Blast resistance markerDepositorInsertscFv-VP64
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18
Plasmid#172318PurposeCRISPR dCas9 SunTag system to target a variant of bacterial DNA methyltransferase MQ1 to install CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_MQ1(Q147L)_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB1678 CMV-HIVNES-GS-Cas13bt1
Plasmid#176316PurposeCMV-HIVNES-GS-Cas13bt1 (human codon optimized Cas13bt1 expression)DepositorInserthuman codon optimized Cas13bt1
UseCRISPRTagsHIV NESExpressionMammalianPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry Codon 59 sgRNA
Plasmid#109431PurposeMLM3636 backbone containing a gRNA that guides Cas9 to codon 59 of mCherry in the ACE reporterDepositorInsertmCherry codon 59 gRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only