We narrowed to 2,259 results for: Xpa
-
Plasmid#115624PurposeTargeted A to G in wheat plants or monocotyledons protoplastsDepositorInsertwtTadA-TadA7.10-NLS-nCas9-NLS
UseCRISPRExpressionPlantAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
PABE-6
Plasmid#115627PurposeTargeted A to G in wheat plants or monocotyledons protoplastsDepositorInsertwtTadA-TadA7.10-nCas9-2*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PABE-5
Plasmid#115626PurposeTargeted A to G in wheat plants or monocotyledons protoplastsDepositorInsertNLS-nCas9-NLS-wtTadA-TadA7.10-NLS
UseCRISPRExpressionPlantAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PABE-4
Plasmid#115625PurposeTargeted A to G in wheat plants or monocotyledons protoplastsDepositorInsertNLS-nCas9-wtTadA-TadA7.10-NLS
UseCRISPRExpressionPlantAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR0SP0021
Plasmid#117532PurposeLevel0 Golden Gate part: CDS, SaCas9 (no stop codon)DepositorInsertSaCas9 (no stop codon)
UseCRISPRAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEB0_1_cusR
Plasmid#236213PurposePlasmid encoding cusR as a Type 3 part to be used in the Dueber Yeast MoClo Toolkit.DepositorInsertcusR
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEB0_14_QS
Plasmid#236217PurposePlasmid encoding QS as a Type 3 part to be used in the Dueber Yeast MoClo Toolkit.DepositorInsertQS
UseSynthetic BiologyExpressionBacterialAvailable SinceMarch 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNDGG015
Plasmid#231336PurposeBEVA Golden Gate cloning vector; Narrow host range plasmid. L1-p15A-Gm-ELT3; pNDGG021, pOGG009, pNDGG006, pOGG013. NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL846
Plasmid#214236PurposeFrCas9 genome editing plasmid in riceDepositorTypeEmpty backboneExpressionPlantAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL847
Plasmid#214237PurposeTREX2-FrCas9 genome editing in riceDepositorTypeEmpty backboneExpressionPlantAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL849
Plasmid#214239PurposeFrCas9 adenine base editing plasmid in riceDepositorTypeEmpty backboneExpressionPlantAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG014
Plasmid#231335PurposeBEVA Golden Gate cloning vector; Narrow host range plasmid. L1-pMB1-Gm-ELT3; pNDGG021, pOGG009, pNDGG007, pOGG013. GmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQGG003
Plasmid#231330PurposeBEVA Golden Gate cloning vector; BEVA2.0 Narrow host range plasmid with I-SceI counterselectable site for BpiI cloning; KmR/NmR.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEC2796 (pSpy0C4)
Plasmid#220280Purposeintegrative plasmid for heterologous gene expression in S. pyogenes SF370, integrates into the sagB locus via homologous recombinationDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK454 (dTAG-BSD)
Plasmid#214384PurposedTAG for C-terminal taggingDepositorInsertdTAG-BSD
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSM045
Plasmid#217399PurposeKmR, pBTRcK broad host range vector with BTE1(C12-specific fatty acid thioesterase codon-optimised for C. necator) under PtrcDepositorInsertBTE1
ExpressionBacterialPromoterPTrcAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSM046
Plasmid#217400PurposeKmR, pBTRcK broad host range vector with BTE2(C12-specific fatty acid thioesterase codon-optimised for C. necator) under PtrcDepositorInsertBTE2
UseSynthetic BiologyExpressionBacterialPromoterPTrcAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only