We narrowed to 13,951 results for: CRISPR-Cas9
-
Plasmid#248341PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only
-
EKv405(Gold Cas-guide insert1)
Plasmid#248334PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv409(Gold Cas-guide insert5)
Plasmid#248338PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV1064
Plasmid#247972PurposeCRISPR-Cas9 vector containing two 20 nt protospacer sequences to target the gene wA in Aspergillus nidulans. pyrG markerDepositorInsertCas9-AMA1-wA-gRNA 1 & 2-pyrG-Ori-AmpR
UseCRISPRMutationnoneAvailable SinceMarch 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_011
Plasmid#59702PurposeThis lentiviral vector can be used to assay Cas9 activity.DepositorInsertEGFP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCasPA
Plasmid#113347PurposeBacterial expression of Cas9 nuclease and λ-Red system in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasAb-apr
Plasmid#121998PurposeBacterial expression of Cas9 nuclease and RecAb recombination system in Acinetobacter baumanniiDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDM028
Plasmid#216809PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and hph selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM068
Plasmid#216811PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and NAT selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM030
Plasmid#216810PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and ble selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEC-red
Plasmid#196040PurposeAllows the expression of Cas9 in Saccharomyces cerevisiae and contains a gRNA expression unit with a mRFP1 placeholder for user-defined gRNA insertion using BsaI-mediated Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Grna cloningExpressionYeastAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSQT834
Plasmid#53371PurposeCsy4 and Cas9 nuclease expression plasmidDepositorInsertCsy4-T2A-Cas9-NLS
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDM026
Plasmid#216808PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and pyrG selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUDP004
Plasmid#101165PurposeE. coli/S. cerevisiae shuttle vector carrying amd S marker and Spcas9D147Y P411T allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC12
Plasmid#104786PurposepNB184-Cas9 entry cassetteDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only