We narrowed to 14,045 results for: crispr grnas
-
Plasmid#88851PurposeCRISPR KO of Trp73DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pMMK ENTR 2 hU6 ACTB sgRNA
Plasmid#206270PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes hU6 hACTB sgRNADepositorInsertACTB sgRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 hU6 HEK3 PegRNA
Plasmid#206277PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes HEK3 PegRNADepositorInsertHEK3 PegRNA
UseCRISPR; Multimate/gateway entr 2ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV2 ITR_phU6_gRNA scaffold-DMD sg1_phU6_gRNA scaffold-DMD sg16_pMHCK7-3x Flag-NLS-enOsCas12f1-NLS_pA_AAV2 ITR
Plasmid#197028PurposeAAV vector encoding a human codon-optimized enOsCas12f1 driven by MHCK7 promoter, DMD-targeting guide RNAs compatible with enOsCas12f1 driven by hU6DepositorInserthumanized enOsCas12f1
UseAAVMutationD52R / T132RPromoterMHCK7, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19-PBBa_J23117-sgRNA-Spr
Plasmid#190793PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.DepositorInsertsgRNA (dummy)
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-full-length-sgRNA
Plasmid#204638PurposeExpression of full-length AsCas12f sgRNA in mammalian cellsDepositorInsertfull-length AsCas12f sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA CAG
Plasmid#50927PurposeU6 driven sgRNA negative controlDepositorInsertnegative control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHR-U6-sgRNA-CMV-puro
Plasmid#169450Purposebackbone for sgRNA expressionDepositorInsertsgRNA
UseLentiviralAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-LbCpf1-pre-gRNA
Plasmid#137848PurposeLbCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertLbCpf1-NLS-FLAG and gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TS2
Plasmid#69234PurposeU6 driven SpCas9 sgRNA expression for TS2 siteDepositorInsertTS2 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TS3
Plasmid#69235PurposeU6 driven SpCas9 sgRNA expression for TS3 siteDepositorInsertTS3 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TS4
Plasmid#69236PurposeU6 driven SpCas9 sgRNA expression for TS4 siteDepositorInsertTS4 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MP-84-spCas9-U6-gRNA
Plasmid#206935PurposeExpression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.DepositorInsertspCas9
UseAAVTagsSV40 NLSExpressionMammalianPromoterMP-84Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only