We narrowed to 7,233 results for: CAD;
-
Plasmid#25743PurposeControl lentiviral vector with Tet-based inducible expression of Luciferase miR30-based shRNA, constitutive Neomycin resistance gene coexpression.DepositorInsertLuciferase miR-shRNA
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-puro-3xFLAG-RUNX3 R122C
Plasmid#203439PurposeMammalian expression of RUNX4DepositorAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/GCCACC-mEGFP-IRES-mCherry
Plasmid#49226PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Lrat
Plasmid#206345PurposeAAV plasmid expressing LRAT in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/CGA-mEGFP-IRES-mCherry
Plasmid#49233PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinVenus-S1033A
Plasmid#211896PurposeVinculin (chicken) with S1033 unphosphorylatable point mutation (S1033A) tagged with VenusA206K at the C-terminus, in lentiviral expression vector.DepositorInsertVinculinVenus-S1033A (VCL Chicken)
UseLentiviralTagsVenusA206KMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinVenus-S1033D
Plasmid#211897PurposeVinculin (chicken) with S1033 phosphomimetic point mutation (S1033D) tagged with VenusA206K at the C-terminus, in lentiviral expression vector.DepositorInsertVinculinVenus-S1033D (VCL Chicken)
UseLentiviralTagsVenusA206KMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCsy3-VPR-Csy4
Plasmid#153943PurposeExpresses type I-F P. aeruginosa cascade (PaeCascade) proteins Csy3-VPR and Csy4 in mammalian cellsDepositorInsertCsy3-VPR, Csy4
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCsy1-Csy2
Plasmid#153942PurposeExpresses type I-F P. aeruginosa cascade (PaeCascade) proteins Csy1 and Csy2 in mammalian cellsDepositorInsertCsy1, Csy2
UseAAV and CRISPRTagsFlagExpressionMammalianPromoterCMVAvailable SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT S65D+T69D+S70D
Plasmid#13617DepositorTagsFLAGExpressionMammalianMutationchanged Serine 65, Thr 69 and Ser70 to AspAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
SNAP-MIDAS
Plasmid#171604PurposeExpresses the SNAP-tagged MIDAS domain of S. pombe Mdn1 (a.a. 4381-4717) in bacteria.DepositorInsertMIDAS domain of S. pombe Mdn1 (a.a. 4381-4717)
TagsHis6 tag and SNAP tagExpressionBacterialAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR.sgKras.9
Plasmid#91894PurposesgRNAs targeting mouse Kras. 3rd generation lentiviral backbone.DepositorInsertKras sgRNA
UseLentiviralPromoterU6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-His-myc-Rbx1
Plasmid#29506DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-GFPi
Plasmid#31849DepositorInsertGFP RNAi
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/CGA-mEGFP-IRES-mCherry
Plasmid#49224PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
3582 pcDNA3 Bad S136E
Plasmid#8800DepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197981PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-ONL
Plasmid#65713PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-ONL)DepositorInsert7xTcf, minCMV, 3xNLS, ONL
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh-Puro-Luci
Plasmid#31850DepositorInsertLuciferase RNAi
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherry-puromycinAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only