We narrowed to 13,167 results for: Green Fluorescent Protein
-
Plasmid#190629PurposeBacterial expression of genetically encoded protease indicator SPW-HHLDepositorInsertSPW-HHL
ExpressionBacterialAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-SCW
Plasmid#190633PurposeMammalian expression of genetically encoded calcium indicator SCWDepositorInsertSCW
ExpressionMammalianAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC533 - pAAV SYN1 eGFP-2A-mKv1.2
Plasmid#75295PurposeAn AAV packaging vector that expresses eGFP and Kv1.2 under the control of a neuronal promoter.DepositorAvailable sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-RhoA-wt_mScarlet-i_SGFP2
Plasmid#85071PurposeGreen/red FRET biosensor to monitor RhoA nucleotide loading state and activityDepositorInsertRhoA Biosensor wildtype with mScarlet-i and SGFP2 (RHOA Human)
Tags6xHis and mScarlet-i and SGFP2ExpressionBacterial, Insect, and Mamm…PromoterCMVAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C1-PRKAA1
Plasmid#30305DepositorAvailable sinceJuly 21, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable sinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX.3'UTR
Plasmid#181872PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoter (includes a large portion of the Slc8b1 3'UTR)DepositorInsertsUseAAV and AdenoviralTagsHA, T2A, and mycExpressionMammalianMutationincludes a large portion of the Slc8b1 3'UTR…Promotersynthetic hybrid CAG promoterAvailable sinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD-hfYFP
Plasmid#186522PurposeHyperfolder YFP fluorescent protein: bacterial expression plasmidDepositorInsertHyperfolder YFP
Tags6xHisExpressionBacterialMutationmGreenLantern-F46L/C48S/V68L/A69M/C70V/K101E/T105…PromoteraraBAvailable sinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCS2 CA-LRP6-GFP
Plasmid#29682DepositorPublicationInsertLDL-receptor related protein 6 (LRP6 Human)
TagsGFPExpressionMammalianMutationextracellular region deletedAvailable sinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorInsertsUseFluorescent reporterPromoter1.7kb fabp6Available sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCHMP2A-NS3-Green
Plasmid#223440PurposeMammalian expression of CHMP2A fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP2A (CHMP2A Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCHMP4B-NS3-Green
Plasmid#223528PurposeMammalian expression of CHMP4B fused to the hepatitis C virus protease NS3 through a short linker containing the NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP4B (CHMP4B Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
tdp43-EGFP construct4
Plasmid#28197DepositorPublicationInsertTar DNA binding protein (TARDBP Human)
TagsEGFPExpressionMammalianMutationaa216-414 onlyAvailable sinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-Rab8a-wt
Plasmid#86075PurposeA mammalian expression plasmid encoding Rab8a wild type with N-terminus EGFP.DepositorAvailable sinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOBCol3.6-MCS
Plasmid#108311PurposeDrive inserted gene in type 1 collagen expressing cells.DepositorTypeEmpty backboneTagsNoneExpressionMammalianAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBADHisB-Sumo-mBaoJin
Plasmid#229580PurposeExpresses mBaoJin in bacterial cellsDepositorInsertmBaoJin
ExpressionBacterialAvailable sinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
opto-E-cad GFP
Plasmid#203327PurposeExpresses E-cadherin with a LOV2 insert after T133 for blue light inhibition in mammalian cellsDepositorInsertPhotoswitchable - E-cadherin with GFP tag (CDH1 Human)
TagsGFPExpressionMammalianMutationAddition of Aslov2 domain at T133 of human E-cadh…Available sinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBItetDT240GFP
Plasmid#96904Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 240 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable sinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by