We narrowed to 3,654 results for: cmv promoter
-
Plasmid#251331PurposeExpression of mKate2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmKate2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
EW488 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(T2098L)
Plasmid#236159PurposeExpress NZF transcriptional activation domain fused to a deimmunized linker and mTOR FRB rapamycin binding domain with the T098L mutation, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationT2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO GFP-Zeo DEST (719-1)
Plasmid#17431Purpose3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter, GFP-ZeoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseGateway Cloning and LentiviralExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMVie-IRES-BlastR alt MCS
Plasmid#120862Purpose3rd generation lentiviral expression under a CMVie promoter with Blasticidin selectionDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterCMV immediate earlyAvailable SinceJan. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-CMV-mCherry-GSG-P2A-NUDT5-WPRE
Plasmid#250386PurposeLentiviral expression of human NUDT5 with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKD011 CMV 3xFLAG-NLS-ZF2-ABI1 in TUPV2
Plasmid#161548PurposeConstitutive expression of 3xFLAG-NLS-ZF2-ABI1 under the CMV promoterDepositorInsert3xFLAG-NLS-ZF2-ABI1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV:: GFP11x7-P2A-NES-FKBP-iLID-LRP6c(△1-64)
Plasmid#221777PurposeExpresses GFP11x7-P2A-NES-FKBP-iLID-LRP6c(△1-64) component in mammalian cellsDepositorInsertpCMV:: GFP11x7-P2A-NES-FKBP-iLID-LRP6c(△1-64)
ExpressionMammalianPromoterCMV promoterAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-mNeon-Puro
Plasmid#239955PurposeLentiviral vector to generate mNeon-tagged MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6-mNeon
UseLentiviralTagsmNeonExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-FLAG-CFP-AMOT
Plasmid#235682PurposeExpress CFP tagged AMOT gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dCas9-3xNLS-VP64 (Construct 1)
Plasmid#55195PurposeExpresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsVP64ExpressionMammalianPromoterCMV/hUBCAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Renilla Luciferase L5-L2
Plasmid#62186PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and renilla luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertRenilla luciferase
UseGateway Cloning and LuciferaseExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA1-NLS(sv40) (BPK5050)
Plasmid#115136PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Luc2 (FF-Luciferase) L5-L2
Plasmid#62168PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseGateway Cloning and LuciferaseExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3.1-NLS(sv40) (RTW2624)
Plasmid#115139PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Luc2 (FF-Luciferase) R4-R3
Plasmid#62169PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseGateway Cloning and LuciferaseExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hOrf2mor-NLS(sv40) (BPK5095)
Plasmid#115141PurposeCMV-T7 promoter expression plasmid for human codon optimized Orf2mor anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized Orf2mor anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
EW499 CMV-TO-NZF-(GGS)x8[G1W S3D S6T G7L S9L G11M G14N G17D G19V G22W]-FRB(N2093W, T2098L)
Plasmid#236146PurposePlasmid encoding the NZF transcriptional activation domain attached by a deimmunized linker to FRB with N2093W and T098L mutations, under control of CMV promoter with two TetR binding sitesDepositorInsertNZF-deImmunLink-FRB
ExpressionMammalianMutationN2093W, T2098L in FRBPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRZ315:CMVp-BD6-AS (50bp)2mm(18-19)-(Canonical V13'SE)-mK2-Ex2-(linker4)-pA
Plasmid#251324PurposeExpression of mK2-Ex2 under CMVp promoter for use in synthetic gene circuitsDepositorInsertmK2-Ex2
ExpressionMammalianPromoterCMVpAvailable SinceApril 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-NF2-CFP
Plasmid#235687PurposeExpress CFP tagged NF2 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC592 - pCMV Mito-iRFP
Plasmid#59135PurposeA plasmid that express mitochondrial-targeted iRFP under the CMV promoter.DepositorInsertMitochondria-localized Infrared Fluorescent Protein
TagsMitochondria-targeting sequenceExpressionMammalianPromoterCMV-IEAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-MST2
Plasmid#235688PurposeExpress RFP tagged MST2 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC591 - pCMV Mem-iRFP
Plasmid#59134PurposeA plasmid that express membrane-targeted iRFP under the CMV promoter.DepositorInsertMembrane-localized Infrared Fluorescent Protein
TagsPalmitylation signalExpressionMammalianPromoterCMV-IEAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP2u2-CMV-Ace2-IgG1
Plasmid#226455PurposeMammalian expression of human Ace2 protein under CMV promoter fused with IgG1, tagged with 6His, and released extracellular environment after expression for protein purificationDepositorInsertsAngiotensin Converting Enzyme 2
Immunoglobulin Heavy Constant Gamma 1
Tags6xHis TagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1751 - pcDNA3.1 CMV-IE V5-ER-LBD
Plasmid#201818PurposeA plasmid expressing the ligand-binding domain of estrogen receptor with a V5 epitope tag from a CMV promoterDepositorInsertV5-ER-LBD
ExpressionMammalianPromoterCMV-IEAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only