We narrowed to 33,723 results for: cmv
-
Plasmid#204340PurposeGPCR/G protein BRET biosensorDepositorInsertGalpha-s/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
EK0208 CMV-TO-BFPmut-stop-t70587 (FLP-IN)
Plasmid#191138PurposeExpression of Trigger 1 in 3' UTR of an inactive BFP in mammalian cellsDepositorInsertt70587
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Pink Flamindo-p2a-bPAC
Plasmid#202716PurposeMammalian co-expression of soluble Pink Flamindo, a fluorescent cAMP indicator and soluble bPAC, a photoactivatable adenylyl cyclaseDepositorArticleInsertsPink Flamindo
bPAC
UseLentiviralTags10xHis and mycExpressionMammalianPromoterCMVAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-HF1-P2A-EGFP (RTW5000)
Plasmid#139996PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG-HF1(SpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpG-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R; HF…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) PHLDB1
Plasmid#107503PurposeExpresses PHLDB1, puromycin resistantDepositorInsertPHLDB1 (PHLDB1 Human)
UseLentiviralExpressionMammalianMutationNucleotide changes 1236 T>C, 1365 C>T, 1371…PromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniMutationdead Cas9Available SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRP.ExTri-CMV-5'UTR-ApoB48-Linker-eGFP
Plasmid#138334PurposeExpresses APOB-Linker-eGFPDepositorAvailable SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B G120A
Plasmid#123235PurposeExpresses mCherry-EGFP-LC3B G120A in mammalian cells. Negative control for tandem reporter. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO GFP-Zeo DEST (719-1)
Plasmid#17431Purpose3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter, GFP-ZeoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Destination vectorExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-i3-IRESWT-Gbetagamma ONE-GO
Plasmid#204341PurposeGPCR/G protein BRET biosensorDepositorInsertGalpha-i3/Gbetagamma ONE-GO
UseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
TDP-REGv2(Gaussia Luciferase)#5 in pTwist-CMV
Plasmid#216164PurposeExpression of secreted Gaussia Luciferase specifically in cells with TDP-43 loss of function. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertGaussia princeps luciferase (with double mutation to improve stability)
ExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCCL-dNTP63Promoter-FLuc-CMV-RLuc-dsRed2
Plasmid#215326PurposeLentiviral mammalian vector with firefly luciferase reporter for dNTP63 expression; renilla luciferase and dsRed2 reporter under CMV promoter.DepositorInsertdNTP63 Promoter
UseLentiviral and LuciferaseExpressionMammalianPromoterdNTP63Available SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2T-cmv-SpCas9-TadCBEd-V106W-BlastR
Plasmid#193849PurposeExpress TadCBEd-V106W in mammalian cells with BlastR selection, Tol2 integrationDepositorInsertTadCBEd-V106W
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIR-CMV-SCN2A-Variant-4-IRES-mScarlet
Plasmid#209410PurposeExpression of wild-type neonatal isoform of human SCN2A.DepositorInsertSCN2A Variant 4, stabilized (SCN2A Human)
ExpressionMammalianMutationIVS intron inserted after bp 4551 of the SCN2A OR…PromoterCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-eGFP-hTau P301L-WPRE
Plasmid#233043PurposeTo Express a GFP human Tau P301L fusion protein from a CMV promoterDepositorAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA
Plasmid#55201PurposePlasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Puro-CMV>{5-HT6-R_GECO1.1}
Plasmid#232879PurposeExpresses the 5-HT6R coupled to the RGECO1 calcium sensorDepositorInsert5-Hydroxytryptamine Receptor 6 (HTR6 Human)
UseLentiviralTagsRGECO1.1ExpressionMammalianPromoterCMVAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TCARZ-CMV-Cherry-PAmin-GF3-R4A22
Plasmid#203770PurposeFor production of template RNA for use in PRINT, mCherry under CMV promoterDepositorInsertPRINT template RNA for mCherry
UseIvt templatePromoterCMVAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only