We narrowed to 6,201 results for: org
-
Plasmid#99675PurposeExpresses dSp Cas9 fused at C term. To VP64 and RTA activation domainsDepositorArticleInsertdCas9
TagsVP64-RTAExpressionMammalianMutationdead Cas9Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas9m3-VP64
Plasmid#47318PurposeCas9m3 ActivatorDepositorInsertCas9m3-VP64
UseCRISPRAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pT7-stl
Plasmid#51721Purposeconditional gene knockdowns in Trypanosoma bruceiDepositorTypeEmpty backboneUseConditional gene knockdown in t. bruceiPromoterT7 (2X)Available SinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PGK-LAMP1-AlfaTag-APEX2
Plasmid#253244PurposeExpress LAMP1 fused to APEX2 peroxidase to map the spatial organization of the lysosomal membrane and its associated proteins. LAMP1 is also fused to AlfaTag for IF or WB detection.DepositorAvailable SinceMay 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
PTGR-PS2-SpyTAG
Plasmid#237443PurposeExpressing PS2 (SpyTAG) S-layer from C. glutamicum under its native promoterDepositorInsertcpsB-SpyTAG
TagsSpyTAGExpressionBacterialAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaNL
Plasmid#216911PurposeMega' with knockout of GvpN and GvpLDepositorInsertMega' with knockout of GvpN and GvpL
ExpressionBacterialAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRLS
Plasmid#216955PurposeMega' with knockout of GvpR, GvpL and GvpSDepositorInsertMega' with knockout of GvpR, GvpL and GvpS
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLT
Plasmid#216933PurposeMega' with knockout of GvpL and GvpTDepositorInsertMega' with knockout of GvpL and GvpT
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaJU
Plasmid#216943PurposeMega' with knockout of GvpJ and GvpUDepositorInsertMega' with knockout of GvpJ and GvpU
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaKJ
Plasmid#216939PurposeMega' with knockout of GvpK and GvpJDepositorInsertMega' with knockout of GvpK and GvpJ
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLSK
Plasmid#216957PurposeMega' with knockout of GvpL, GvpS and GvpKDepositorInsertMega' with knockout of GvpL, GvpS and GvpK
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLS
Plasmid#216930PurposeMega' with knockout of GvpL and GvpSDepositorInsertMega' with knockout of GvpL and GvpS
ExpressionBacterialAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRS
Plasmid#216904PurposeMega' with knockout of GvpR and GvpSDepositorInsertMega' with knockout of GvpR and GvpS
ExpressionBacterialAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaB
Plasmid#216879PurposeMega' with knockout of GvpBDepositorInsertMega' with knockout of GvpB
ExpressionBacterialAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRN
Plasmid#216900PurposeMega' with knockout of GvpR and GvpFDepositorInsertMega' with knockout of GvpR and GvpF
ExpressionBacterialAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaKU
Plasmid#216941PurposeMega' with knockout of GvpK and GvpUDepositorInsertMega' with knockout of GvpK and GvpU
ExpressionBacterialAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only