We narrowed to 10,769 results for: ESP
-
Plasmid#166856PurposeHuman expression vector encoding full length SARS CoV-2 spike protein, containing biotinylation site and 8His-tag. Modification of Addgene plasmid #154754.DepositorInsertSARS CoV-2 HexaPro full length spike protein (S Severe acute respiratory syndrome-related coronavirus)
Tags8xHis and Biotinylation siteExpressionMammalianAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-NES-ZapCV2 (cpV143)
Plasmid#112060PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)DepositorInsertNES-ZapCV2
TagsNuclear Export Signal (NES) derived from HIV-1ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…PromoterCMVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
51_pAAV-ProC12-CatCh-GFP-WPRE
Plasmid#125947PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC12Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-TFIIE
Plasmid#171083PurposeCo-expresses human TFIIE. The resulting plasmid was used to generate a single expression construct encoding 2 subunits, with His-tag on TF2E1.Originally from MN Gonzalez, was submitted with permissionDepositorTagsHisExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish ArcLight Q175
Plasmid#53616PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertZebrafish ArcLight-Q175 (tpte Synthetic, Aequorea victoria, Zebrafish)
ExpressionMammalianMutationDr-VSD contains R153Q mutation and an amino acid …PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
161_pAAV-ProD5-CatCh-GFP-WPRE
Plasmid#125981PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD5Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
113_pAAV-ProC21-CatCh-GFP-WPRE
Plasmid#125956PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC21Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
I_pAAV-ProA6-CatCh-GFP-WPRE
Plasmid#125890PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA6Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
198_pAAV-ProD1-CatCh-GFP-WPRE
Plasmid#125977PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD1Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
VI_pAAV-ProA7-GFP-WPRE
Plasmid#125891PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVPromoterProA7Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
136_pAAV-ProA1-CatCh-GFP-WPRE
Plasmid#125886PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA1Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
57_pAAV-ProA14-CatCh-GFP-WPRE
Plasmid#125897PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA14Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-FBXL5-SKP1
Plasmid#226620PurposeCo-expression of FBXL5-SKP1 complex in E.coliDepositorTagsGB1ExpressionBacterialMutationAmino acids 1-198 was deleted, and 420-596 was re…PromoterT7Available SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
124_pAAV-ProC3-CatCh-GFP-WPRE
Plasmid#125939PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC3Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA18-GCaMP6s
Plasmid#126004PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProA18Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA5-GCaMP6s
Plasmid#126003PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProA5Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.1.7
Plasmid#171747PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-B.1.1.7 variant (UK)DepositorInsertSpike (S-GSAS-B.1.1.7 variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
206_pAAV-ProD17-CatCh-GFP-WPRE
Plasmid#125993PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
70_pAAV-ProA23-CatCh-GFP-WPRE
Plasmid#125906PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA23Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
III_pAAV-ProB4-CatCh-GFP-WPRE
Plasmid#125924PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB4Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
151_pAAV-ProC29-CatCh-GFP-WPRE
Plasmid#125964PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC29Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
17_pAAV-ProB1-CatCh-GFP-WPRE
Plasmid#125921PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB1Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX
Plasmid#124258PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
107_pAAV-ProC17-CatCh-GFP-WPRE
Plasmid#125952PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC17Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-P1-like
Plasmid#173789PurposeMammalian expression of SARS-CoV-2 Spike protein P-1-like variant (K417N)DepositorInsertSpike S-GSAS- P-1-like variant (K417N) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
119_pAAV-ProC25-CatCh-GFP-WPRE
Plasmid#125960PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC25Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
62_pAAV-ProA19-CatCh-GFP-WPRE
Plasmid#125902PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA19Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only