We narrowed to 11,722 results for: Vars
-
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-P2A-EGFP (RTW3027)
Plasmid#139987PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9 with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Hinge Notch SNIPR (HNF1A, ALPPL2 scFv)
Plasmid#188385PurposeLentiviral vector - constitutive expression of an anti-ALPPL2 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a HNF1A(DBD)-p65(361-551) transcriptional factorDepositorInsertPGK_antiALPPL2_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_HNF1A(DBD)-p65(361-551)
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-RNF168
Plasmid#133976Purposemammalian expression vector of Flag tagged wild type RNF168DepositorAvailable SinceMarch 4, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP-PH-FAPP1
Plasmid#161986PurposeExpresses GFP-tagged PH-FAPP1. PI(4)P biosensorDepositorAvailable SinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBS1449 SED1-Lenti
Plasmid#180824PurposeSED1 biosensor for stable integration and expression in mammalian cellsDepositorInsertSED1 osmosensor
UseLentiviralPromoterCMVAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.4_CEACAM6-His
Plasmid#149337Purposefor eukaryotic expression and purification of CEACAM6-His6DepositorInsertCEACAM6 (CEACAM6 Human)
TagsIL-2 signal peptide and polyhistidineExpressionMammalianMutationpoint mutation (GGA to GCA) to replace 'G-g…PromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B
Plasmid#103002Purposenon-standard AAV2 rep-AAV-PHP.B cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
CoV2-Spike-D614G
Plasmid#177960PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Spike protein (original Wuhan Hu1 sequence + D614G mutation)DepositorInsertSARS-CoV-2 Spike protein (original Wuhan Hu1 sequence + D614G mutation) (S )
ExpressionMammalianMutationD614GAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-MRLC-WT-GFP
Plasmid#187258PurposeLentiviral expression of myosin regulatory light chain-WTDepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HTR2A-NTEV-TCS-GV-2xHA
Plasmid#194366PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_CDK4-P2A-Hygro_Barcode
Plasmid#170223PurposeBarcoded lentiviral vector to express CDK4 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP-C-IFT88
Plasmid#218733PurposeExpresses N-terminally EGFP-tagged IFT88 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-RET-V5/HIS
Plasmid#205606PurposeExpression of human RET receptor tyrosine kinase in mammalian cellsDepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Luc-PS9
Plasmid#177942PurposeTransient mammalian expression of Luc2 (firefly luciferase) along with SARS-CoV-2 sequence 20080-21171 (PS9) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInsertLuc2 (ORF1ab )
ExpressionMammalianAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TRKB-V5/HIS
Plasmid#205614PurposeExpression of human TRKB receptor tyrosine kinase in mammalian cellsDepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
Plasmid#221233PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)DepositorInsertSpCas9(D10A)-P2A-EGFP
ExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Elafin
Plasmid#18102DepositorInsertElafin (PI3 Human)
ExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pKlab1194-pcDNA-3.1-BACH1/BRIP1/FANCJ-3xFLAG-V5
Plasmid#249002PurposeThis plasmid expresses the BACH1 protein sequence for pull down assaysDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only