We narrowed to 15,607 results for: nol
-
Plasmid#185968PurposeMolecular IMPLY gate, encodes mutant Ci protein from Plteto-1 promoter, and EGFP form PR and PlTataa promoter. Must be expressed in E.coli DH5alphaz1 for experimental characterization.DepositorInsertMolecular IMPLY gate
UseSynthetic BiologyAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
2xNLS-NLP-cMyc AspCas12a
Plasmid#182120PurposepET21a protein expression vector for 2xNLS-NLP-cMyc AspCas12a in bacteriaDepositorInsert2xNLS-NLP-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIALD2HMGr
Plasmid#185867PurposeKnocking out ALD6; expressing acetylating aldehyde dehydrogenase (Lactobacillus reuteri pduP and L. reuteri EutE) and an NADH-preferring HMG-CoA reductase (Delftia acidovorans mvaA) in S. cerevisiaeDepositorInsertALD6(-125, 40)> PSk.GAL1>Da.mvaA>TPGK1-PADH1> Lr.pduP> TPDC1-PGAL2>Lr.EutE-ALD6(1054, 1749)
ExpressionYeastMutationNoneAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNB_EA_R3tdTomatoi2
Plasmid#185969PurposeExpresses tdTomato from PR promoter with optimized RBS (i2) in E.coli Dh5alpha cell. The construct is in reverse direction network brick.DepositorInsertPr-i2rbs-tdTomato cassette in reverse direction in Network Brick
UseSynthetic BiologyPromoterPRAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pv6_CBX7_Chromo-W35A_TAF3_Phd
Plasmid#179401PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of CBX7_Chromo(W35A) - TAF3_PhdDepositorInsertCBX7_Chromo(W35A) - TAF3_Phd
TagsAviTag and EGFPExpressionMammalianMutationChromodomain W35APromoterCAGGSAvailable SinceAug. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-742pUC19-tNGFR-P2A-Caspase8
Plasmid#186099PurposeKnockin of truncated NGFR to target geneDepositorInsertCASPASE8
UseCRISPRMutationWT with tNGFR sequenceAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-UL29-U3-UL8
Plasmid#166685PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (non-EGFP version).DepositorAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV126
Plasmid#124250PurposeIn vitro transcription plasmid for T7 transcription of wildtype Her2 sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV127
Plasmid#124251PurposeIn vitro transcription plasmid for T7 transcription of Her2 ITD sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV128
Plasmid#124252PurposeIn vitro transcription plasmid for T7 transcription of KRAS WT sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV129
Plasmid#124253PurposeIn vitro transcription plasmid for T7 transcription of KRAS G12V sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-nCas9
Plasmid#163538PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)eA3A T31AAvailable SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-nCas9
Plasmid#163564PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)Available SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-RNF169UBD
Plasmid#119009PurposeMammalian expression of a fusion protein of human BRCA1 with the human RNF169 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-Rad18UBD
Plasmid#119008PurposeMammalian expression of a fusion protein of human BRCA1 with human Rad18 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-N-Flag-Snrnp40
Plasmid#134249PurposeLentivector encoding Flag-tagged Snrnp40DepositorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Met133I, M1381I, M186I ELL2
Plasmid#127263PurposeFor in vitro translation of human ELL2 with Met133I, M1381I, M186IDepositorInsertELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to IleuPromoterT7Available SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
563aa ELL2 pEF4B
Plasmid#127273PurposeExpresses 563aa human WT ELL2DepositorInsertELL2 truncated at SphI (ELL2 Human)
ExpressionMammalianMutationContains 564 N-terminal amino acids ELL2, termina…PromoterpEF1aAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKdH_P-GAP-ScACS1*
Plasmid#126736Purposeyeast plasmid overexpressing ACS1 from Saccharomyces cerevisiaeDepositorInsertacs1*
Tags6xHis,MycExpressionYeastMutationT3542C and A30S, P113S, and S629N (please see dep…PromoterGAPAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKdH_P-GAP-ScADH2+P-GAP*-ScACS1*
Plasmid#126738Purposeyeast plasmid overexpressing ADH2 and ACS1 from Saccharomyces cerevisiaeDepositorInsertadh2,acs1*
Tags6xHis,MycExpressionYeastMutationT3542CPromoterGAPAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2
Plasmid#127270PurposeFor in vitro translation of human WT ELL2 with internal HA tagDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationWT Mets and HA tag at SphI site (8th Met)PromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2
Plasmid#127274PurposeExpresses human ELL2 with HA tag in the middle that does not disrupt functionDepositorInsertELL2 with HA at XbaI (ELL2 Human)
ExpressionMammalianMutationHA inserted at XbaI after Met 186PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met138ILeu ELL2
Plasmid#127260PurposeFor in vitro translation of human ELL2 with Met138 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met138 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet138 to Ileu QuikchangePromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met186ILeu ELL2
Plasmid#127261PurposeFor in vitro translation of human ELL2 with Met186 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met186 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet186 to Ileu QuikchangePromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met138ILeu, Met186ILeu ELL2
Plasmid#127265PurposeFor in vitro translation of human ELL2 with Met138ILeu, Met186ILeuDepositorInsertELL2 (Met138ILeu, Met186ILeu) (ELL2 Human)
UseIn vitro translationMutationTwo Mets (138,186) to ILeu QuikchangePromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met133ILeu ELL2
Plasmid#127259PurposeFor in vitro translation of human ELL2 with Met133 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met133 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet133 to Ileu QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met133ILeu, Met186ILeu ELL2
Plasmid#127264PurposeFor in vitro translation of human ELL2 with Met133ILeu, Met186ILeuDepositorInsertELL2 (Met133ILeu, Met186ILeu) (ELL2 Human)
UseIn vitro translationMutationTwo Mets (133,186 )to ILeu QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met331Leu ELL2
Plasmid#127262PurposeFor in vitro translation of human ELL2 with Met331 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met331 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet331 to ILeu QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
COOHend ELL2
Plasmid#127255PurposeExpresses the C terminal segment of human ELL2 in mammalian cellsDepositorInsertELL2 (C-terminal end) (ELL2 Human)
UseOtherExpressionMammalianMutationcontains only the last 389 aaPromoterpEF1aAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Met1ILeu ELL2
Plasmid#127258PurposeFor in vitro translation of human ELL2 with Met1 mutated to Ileu to ask if there is internal initiationDepositorInsertELL2 (Met1 to Ileu) (ELL2 Human)
UseIn vitro translationMutationMet1 to Ileu by QuikchangePromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ELL2mRNA+polyA
Plasmid#127256PurposeFor in vitro translation of human ELL2 with 30 nt pA tailDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationshortens 3'UTR to 40 bp adds A30 tailPromoterT7Available SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NH2end ELL2
Plasmid#127252PurposeExpresses the N terminal segment of human ELL2 in mammalian cellsDepositorInsertELL2 (1-287) (ELL2 Human)
UseOtherTagsHis6XExpressionMammalianMutationcontains only amino acids 1-289PromoterpEF1aAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2
Plasmid#127268PurposeFor in vitro translation of WT ELL2 with HA tag inserted near N-termDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationELL2mRNA+polyA with HA tag inserted at aa12 betwe…PromoterT7Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK_P-GAP-LM_lacO-cP-AOX1-sAR
Plasmid#126745Purposeyeast plasmid overexpressing sLovA,CPR and LacI-Mit1ADDepositorInsertslovA,cpr
Tags6xHisExpressionYeastPromoterGAPAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only