1,878 results
-
Plasmid#200337PurposemScarlet BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001535, gcy-8Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
ExpressionWormPromoter15xUAS::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB88
Plasmid#199321PurposeCombine with Gal4 to direct TeNL expressionDepositorInsert15xUAS::delta pes-10::::TeNL::let-858 3'UTR
ExpressionWormMutationKD for calcium is 250 nM, 1 synthetic intronPromoter15xUAS::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
ExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT353
Plasmid#204506PurposeIn vitro transcription of RNA probes for in situ hybridization of CeRep55 lncRNAs in nematode (after linearization with NotI and BglI)DepositorInsertCeRep55 tandem repeats from Y73B3A (C. elegans)
UseOtherPromoterdouble-T7Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT346
Plasmid#204505Purpose5S rDNA used as a probe for chromosome FISH in nematodeDepositorInsert5S rDNA (C. elegans)
UseOtherPromoterT7Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
Tags2xHAExpressionWormPromoterrpl-21 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
Tags2xFLAGExpressionWormPromotercsr-1 (C. elegans)Available SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT334
Plasmid#204516PurposeBacterial expression of COH-3 C-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertC-terminal fragment of coh-3 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT203
Plasmid#204512PurposeBacterial expression of C04F12.1 with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertC04F12.1 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT239
Plasmid#204522PurposeIn vitro transcription of Mos1 transposase mRNA with SL1 and poly(A) used for microinjection into nematodeDepositorAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT517
Plasmid#204518PurposeBacterial expression of CEC-4 with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertcec-4 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT186
Plasmid#204513PurposeBacterial expression of CSR-1 PAZ domain with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertPAZ domain of csr-1 (C. elegans) (csr-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT521
Plasmid#204520PurposeBacterial expression of CEC-5 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-5 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT182
Plasmid#204511PurposeBacterial expression of catalytically defective CSR-1a with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertcsr-1a with D769A mutation (C. elegans) (csr-1 Nematode)
Tags6xHis, MBPExpressionBacterialMutationD769APromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT520
Plasmid#204519PurposeBacterial expression of CEC-8 N-terminal fragment with 6xHis and maltose binding protein tags for in vitro assaysDepositorInsertN-terminal fragment of cec-8 (C. elegans) (Y55B1BR.3 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT342
Plasmid#204514PurposeBacterial expression of SYP-1 N-terminal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertN-terminal fragment of syp-1 (C. elegans)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT320
Plasmid#204517PurposeBacterial expression of HIM-1 internal fragment with 6xHis and maltose binding protein tags for use as an antigenDepositorInsertInternal fragment of him-1 (C. elegans) (him-1 Nematode)
Tags6xHis, MBPExpressionBacterialPromoterT7lacAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmCardinal-T2A-HO1
Plasmid#197249PurposeExpresses the protein of wmCardinal-T2A-HO1 in neurons of C. elegansDepositorInsertwmCardinal-T2A-HO1
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP720-T2A-HO1
Plasmid#197248PurposeExpresses the protein of wmiRFP720-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP720-T2A-HO1
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmNeonGreen
Plasmid#197242PurposeExpresses the protein of wNeonGreen in neurons of C eleganDepositorInsertwmNeonGreen
ExpressionWormAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-sCAG-GluClα.CreON
Plasmid#196995PurposeCre recombinase dependent expression of GluClv2.0 alpha subunit. GluClα contains a Cerulean tag. When co-expressed with GluClv2.0 beta subunit, agonist (Ivermectin) induces neuronal silencing.DepositorInsertGluClα -Cerulean
UseAAV and Cre/LoxTagsCeruleanPromotershort CAGAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH86 - [AWCp | gfp | tbb-2 UTR]
Plasmid#200360Purposegfp BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00012770, srt-47Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH82 - [PVTp | gfp | tbb-2 UTR]
Plasmid#200356Purposegfp BioPart for PVT neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVTp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00006979, zig-2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH84 - [AVHp | gfp | tbb-2 UTR]
Plasmid#200358Purposegfp BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00011327, hlh-34Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH81 - [PVTp | wrmScarlet | tbb-2 UTR]
Plasmid#200355PurposemScarlet BioPart for PVT neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVTp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00006979, zig-2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH59 - [ASELp | wrmScarlet | tbb-2 UTR]
Plasmid#200333PurposemScarlet BioPart for ASEL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASELp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001533, gcy-6Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH89 - [AWCp | wrmScarlet | tbb-2 UTR]
Plasmid#200363PurposemScarlet BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00016049, srt-28Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH88 - [IL2LRp | gfp | tbb-2 UTR]
Plasmid#200362Purposegfp BioPart for IL2LR neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[IL2LRp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00015977,C18f10.2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH87 - [IL2LRp | wrmScarlet | tbb-2 UTR]
Plasmid#200361PurposemScarlet BioPart for IL2LR neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[IL2LRp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00015977,C18f10.2Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH90 - [AWCp | gfp | tbb-2 UTR]
Plasmid#200364Purposegfp BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00016049, srt-28Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH58 - [ASERp | gfp | tbb-2 UTR]
Plasmid#200332Purposegfp BioPart for ASER neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASERp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00001532, gcy-5Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH57 - [ASERp | wrmScarlet | tbb-2 UTR]
Plasmid#200331PurposemScarlet BioPart for ASER neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASERp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00001532, gcy-5Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH54 - [AVKp | gfp | tbb-2 UTR]
Plasmid#200330Purposegfp BioPart for AVK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVKp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00018002, twk-47Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH53 - [AVKp | wrmScarlet | tbb-2 UTR]
Plasmid#200329PurposemScarlet BioPart for AVK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVKp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00018002, twk-47Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH52 - [DDp | gfp | tbb-2 UTR]
Plasmid#200328Purposegfp BioPart for DD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[DDp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00007304, ttr-39Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH48 - [ADLp | gfp | tbb-2 UTR]
Plasmid#200324Purposegfp BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00011644, T09B9.3Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH62 - [ASELp | gfp | tbb-2 UTR]
Plasmid#200336Purposegfp BioPart for ASEL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASELp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00001534, gcy-7Available SinceJune 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH74 - [ASKp | gfp | tbb-2 UTR]
Plasmid#200348Purposegfp BioPart for ASK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASKp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00005033, sra-7Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH70 - [OLQp | gfp | tbb-2 UTR]
Plasmid#200344Purposegfp BioPart for OLQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[OLQp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00003841, ocr-4Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH69 - [OLQp | wrmScarlet | tbb-2 UTR]
Plasmid#200343PurposemScarlet BioPart for OLQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[OLQp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00003841, ocr-4Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH73 - [ASKp | wrmScarlet | tbb-2 UTR]
Plasmid#200347PurposemScarlet BioPart for ASK neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ASKp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00005033, sra-7Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH75 - [ADFp | wrmScarlet | tbb-2 UTR]
Plasmid#200349PurposemScarlet BioPart for ADF neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADFp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00005359, srh-142Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH68 - [PVPp | gfp | tbb-2 UTR]
Plasmid#200342Purposegfp BioPart for PVP neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVPp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00003840, ocr-3Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH67 - [PVPp | wrmScarlet | tbb-2 UTR]
Plasmid#200341PurposemScarlet BioPart for PVP neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVPp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00003840, ocr-3Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH77 - [AWBp | wrmScarlet | tbb-2 UTR]
Plasmid#200351PurposemScarlet BioPart for AWB neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWBp | wrmScarlet | tbb-2 UTR]
ExpressionWormPromoterWBGene00005701, sru-38Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH78 - [AWBp | gfp | tbb-2 UTR]
Plasmid#200352Purposegfp BioPart for AWB neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWBp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00005701, sru-38Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH76 - [ADFp | gfp | tbb-2 UTR]
Plasmid#200350Purposegfp BioPart for ADF neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADFp | gfp | tbb-2 UTR]
ExpressionWormPromoterWBGene00005359, srh-142Available SinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only