We narrowed to 5,232 results for: Mos
-
Plasmid#171715Purposeexpresses maize Glutamine Synthetase ZmGln1-3 cDNA under the control of the Cassava Vein Mosaic Virus promoter (CsVMV) (cassette 1) and the maize Rubisco small subunit promoter (ZmRbcS) (cassette 2)DepositorInsertZmGln1-3
ExpressionPlantAvailable SinceSept. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD438
Plasmid#168464PurposeFor the insertion pf NLS-mEos3.2-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mEos3.2-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_nocharge_wR
Plasmid#139119Purposeexpress hnRNPA2 LC with no charged residues with R added backDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(R47A)
Plasmid#112722PurposeArg47 within TBP6.7 is the most critical residue in terms of forming interactions with WT TAR. Mutating this amino acid to Ala results in ~600-fold reduction in Kd.DepositorInsert6His-TEV-TBP6.7(R47A)
Tags6His-TEVExpressionBacterialMutationR47APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_EB
Plasmid#66013PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [E:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_FB
Plasmid#66014PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [F:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0063 (pLuxR-pR)_GB
Plasmid#66015PurposeMoClo Basic Part: Controllable promoter - pLuxR(pR) - luxR regulated (right promoter, weak constitutive down regulated by LuxR, C0062 in combination with homoserine lactone (HSL)) [G:R0063:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5A-K5A N23 C11orf83-GFP
Plasmid#65846PurposeMammalian expression of the mutated N terminal part (R5A-K5A N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- R5D-K6D N23 C11orf83-GFP
Plasmid#65847PurposeMammalian expression of the mutated N terminal part (R5D-K5D N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Magoh198delG
Plasmid#30481DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGD-p19
Plasmid#196326Purpose35S promoter-driven expression of the tomato bushy stunt virus p19 RNA silencing suppressorDepositorInserttomato bushy stunt virus p19
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBI121::chitGFP5:AQ
Plasmid#240450PurposeExpression of indicator protein fusion (soluble modified GFP5 & Aequorin) for monitoring calcium concentrations in cell walls of higher plants. See Resource Information.DepositorInsertFusion of Chitinase signal, smGFP5, and Aequorin
ExpressionBacterial and PlantMutationGFP5 for expression plants (PMID 9122158); Solubl…PromoterCauliflower mosaic virus 35S promoter (GenBank AJ…Available SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCK306
Plasmid#110544PurposerhaBAD, a rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteria.DepositorInsertsPrhaBAD
yfp
rhaS
ExpressionBacterialPromoterN/A, PrhaBAD, and kanR promoter (upstream of kanR…Available SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGD-P1/HC-Pro
Plasmid#196328Purpose35S promoter-driven expression of the tobacco etch virus P1/HC-Pro RNA silencing suppressorDepositorInserttobacco etch virus P1/HC-Pro
ExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pNMSB104
Plasmid#199314PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ChRmine::SL2::jRGECO1a::let-858 3'UTR
ExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only