We narrowed to 10,769 results for: ESP
-
Plasmid#172723PurposeEncodes a sfGFP dropout expression cassette in place of Part 3 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part-4 DO
Plasmid#172724PurposeEncodes a sfGFP dropout expression cassette in place of Part 4 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1049-pAAV-mscRE13-minBGpromoter-tTA2-WPRE-hGHpA
Plasmid#163482PurposeDirect-expressing tTA2 AAV Virus. Alias: AiP1049 - pAAV-AiE2013m-minBG-tTA2-WPRE-HGHpADepositorInserttTA2
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE1 (minus strand)
Plasmid#91842PurposeLuciferase reporter for CD69 enhancer (IGI-P0619)DepositorInsertCD69 CaRE1 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (minus strand)
Plasmid#91840PurposeLuciferase reporter for IL2RA enhancer (IGI-P0617)DepositorInsertIL2RA CaRE6 (minus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 C>AAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (plus strand)
Plasmid#91839PurposeLuciferase reporter for IL2RA enhancer (IGI-P0616)DepositorInsertIL2RA CaRE6 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 G>T, rs11256448 A>GAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (plus strand)
Plasmid#91848PurposeLuciferase reporter for CD69 enhancer (IGI-P0625)DepositorInsertCD69 CaRE2 (plus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-CD69 CaRE2 (minus strand)
Plasmid#91843PurposeLuciferase reporter for CD69 enhancer (IGI-P0620)DepositorInsertCD69 CaRE2 (minus strand) (CD69 Human)
UseLuciferaseExpressionMammalianMutationPerfect match to reference sequenceAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_p53(R280K)_V5
Plasmid#136525PurposeUsed as a donor vector to clone into pSLIKDepositorInsertp53(R280K) (TP53 Human)
UseEntry vector for gateway cloningTagsV5Mutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…AvailabilityAcademic Institutions and Nonprofits only -
P3-dCas9-Tet1-GFP-Puro
Plasmid#190728PurposeExpression of human spdCas9-Tet1 fusion for targeted DNA methylation in mammalian cell. EGFP-puromycin double marker under an independent CMV promoter. Cloning backbone for spgRNA (BbsI)DepositorInsertdCas9-tet1
UseCRISPRTags3XFLAG and SV40 NLSExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterpCAGAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1010-pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA
Plasmid#163476PurposeDirect-expressing iCre AAV Virus. Alias: AiP1010 - pAAV-AiE2004m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
Tags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP11818-pAAV-AiE2004m_3xC2-minCMV-SYFP2-WPRE3-BGHpA (Alias: CN1818)
Plasmid#164458PurposeAiE2004m_3xC2 is an optimized enhancer sequence designed to drive AAV-mediated transgene expression in L4/5_IT cortical neuronsDepositorInsertSYFP2
UseAAVPromoterminCMVAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCM-CLYBL-NGN2-BRN3A
Plasmid#165597PurposeDonor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.DepositorInsertsUseCRISPR and TALENExpressionMammalianPromoterCAG, EF-1alpha, Endogenous CLYBL (splice acceptor…Available SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-BRD4-7D
Plasmid#90007Purposeexpresses 7D mutant BRD4DepositorInsertBRD4 (BRD4 Human)
TagsFlagExpressionMammalianMutationChanged 484S to 484D, 488S to 488D, 492S to 492D,…Available SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-BRD4-7A
Plasmid#90006Purposeexpresses 7A mutant BRD4DepositorInsertBRD4 (BRD4 Human)
TagsFlagExpressionMammalianMutationChanged 484S to 484A, 488S to 488A, 492S to 492A,…Available SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQ-Elo-HB-C-A(1-772)
Plasmid#171085PurposeCo-expresses of WT-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorTagsHisExpressionBacterialMutationDeleted N-term 26 amino acids for expression purp…PromoterT5 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP12251-pAAV-AiE0453m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2251)
Plasmid#164453PurposeAiE0453m is an enhancer sequence designed to drive AAV-mediated transgene expression in L5_ET cortical neuronsDepositorInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP978-pAAV-mscRE4-minBGpromoter-FlpO-WPRE-hGHpA
Plasmid#163472PurposeDirect-expressing FlpO AAV Virus. Alias: AiP978 - pAAV-AiE2004m-minBG-FlpO-WPRE-HGHpADepositorInsertFlpO
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP12014-pAAV-AiE2004m-minCMV-SYFP2-WPRE3-BGHpA (Alias: CN2014)
Plasmid#164457PurposeAiE2004m is an enhancer sequence designed to drive AAV-mediated transgene expression in L4/5_IT cortical neuronsDepositorInsertSYFP2
UseAAVPromoterminCMVAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only