We narrowed to 15,073 results for: NTS
-
Plasmid#138560PurposeExpresses human codon-optimized SpCas9-VQR and blasticidin resistance: EFS promoter-VQR-NLS-FLAG-P2A-BSDDepositorInsertVQR
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationD1135V, R1335Q, T1337RPromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFAB3833
Plasmid#47839PurposeBIOFAB RFP reporter plasmid for measuring promoter 8 + BCD1 efficiency.DepositorInsertpromoter 8 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
CoV2-N-A119S
Plasmid#177948PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Nucleocapsid (A119S). Used for generating RNA packaging virus-like particles.DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
SPLINTR BFP v1 backbone
Plasmid#179779PurposeSPLINTR backbone vectorDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterEF1aAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-MYC-ITFG2
Plasmid#87046Purposemammalian expression of ITFG2DepositorAvailable SinceMarch 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T2 SHP2 E76A
Plasmid#8324DepositorAvailable SinceJune 17, 2005AvailabilityAcademic Institutions and Nonprofits only -
pFAB3737
Plasmid#47838PurposeBIOFAB RFP reporter plasmid for measuring promoter 7 + BCD1 efficiency.DepositorInsertpromoter 7 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pWZL Blast H-Ras G12V T35S
Plasmid#12278DepositorInsertH-Ras G12V T35S (HRAS Human)
UseRetroviralExpressionMammalianMutationContains G12V activating mutation. The T35S mutat…Available SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pROF402
Plasmid#155334PurposeBinary vector for expression of FLuc controlled by the blue light-repressible systemDepositorInsertLB_P35Senhancer(-953 to -51)-(C120)5-PhCMVmin-FLuc-T35S_RB
UseLuciferase and Synthetic Biology; Eukaryotic expr…Available SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pROF441
Plasmid#155336PurposeBinary vector for expression of a gRNA targeting AtAP1 promoterDepositorInsertLB_PAtU6-26-gRNA(PAtAP1)-sgRNA_RB
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197966PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAT9751-BEAR-mCherry-preedited
Plasmid#162993PurposeBEAR control plasmid with split mCherry and intact 5' splice siteDepositorInsertmCherry split with an intron between amino acids 119-120
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
CoV2-N-M234I
Plasmid#177955PurposeTransient mammalian expression of codon optimized SARS-CoV-2 Nucleocapsid (M234I). Used for generating RNA packaging virus-like particles.DepositorAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFAB3689
Plasmid#47834PurposeBIOFAB RFP reporter plasmid for measuring promoter 3 + BCD1 efficiency.DepositorInsertpromoter 3 and BCD1
UseSynthetic BiologyExpressionBacterialPromotersee insertAvailable SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
tdp43-EGFP construct10
Plasmid#28203DepositorAvailable SinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJG367
Plasmid#91185PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, H840A double nickase (nAtCas9_H840A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_H840A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJG382
Plasmid#91189PurposeBeYDV replicon T-DNA for gene targeting in tobacco leaves, D10A double nickase (nAtCas9_D10A+gNt_R2+gNt_F2+donor)DepositorInsertnAtCas9_D10A+gNt_R2+gNt_F2+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
782 pMEActMEK
Plasmid#31166DepositorAvailable SinceAug. 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
BtGRK2-sYFP2
Plasmid#137778PurposeVisualization of GRK2DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf42
Plasmid#12730PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf42
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_OTmut
Plasmid#185385PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) control sensor GRAB_OTmut in mammalian cellsDepositorInsertGPCR activation based oxytocin control sensor GRAB_OTmut
ExpressionMammalianPromoterCMVAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf37
Plasmid#12725PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf37
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf48
Plasmid#12736PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf48
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-Mito-7
Plasmid#56508PurposeLocalization: Mitochondria, Excitation: 493, Emission: 509DepositorAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-EWS_1-264
Plasmid#180467PurposeExpresses the construct His8-EWS_1-264 with a TEV cleavage site for the removal of the His8 tagDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only