We narrowed to 9,829 results for: CAG
-
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
ROSA26(MultiFPsΔPuro)
Plasmid#140759PurposeTargeting vector to Gt(ROSA)26 locus for conditional expression of distinct FPs (Venus, mCherry, and mCerulean) responding to each site-specific-recombinase activity (Cre, Dre, and phiC31o).DepositorInsertspuromycin-N-acetyltransferase
Venus
mCherry
mCerulean
UseMouse TargetingPromoterCAGGSAvailable sinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1061-PGK-NeoR-IRES-GFP
Plasmid#75129PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable sinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHeACT-mEGFP-NLS
Plasmid#205003PurposeThe vector contains 1kbp of the upstream and downstream regions of the actin gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the actin gene from Hypsibius exemplaris
UseTardigrade expressionAvailable sinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0917
Plasmid#142198PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGAC
Plasmid#110423PurposeshGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selectionDepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO-RFP-IKZF3-sh3
Plasmid#69044Purpose3rd generation lentiviral vector expressing IKZF3 shRNADepositorAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1puro-shKIBRA-B
Plasmid#40889DepositorAvailable sinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorPublicationInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAP2K1 gRNA (BRDN0001147078)
Plasmid#76211Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FLAG-ADA add back mutant pCMV5
Plasmid#17554DepositorInsertFLAG-FoxO1-ADA
TagsFLAGExpressionMammalianMutationsiRNA-resistant Foxo1 by replacing 3 residues (un…Available sinceOct. 17, 2008AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 with interspersed loops (GAPDH)
Plasmid#180183PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA with interspersed loops (GAPDH Human)
UseAAVExpressionMammalianPromoterHuman U6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRDM9dC(KRAB-SSXRD-PR/SET-dC)-Cas9
Plasmid#186699PurposePlasmid encoding PRDM9dC-Cas9 fusion under CMV promoterDepositorInsertPRDM9dC(KRAB-SSXRD-PR/SET-dC)-Cas9 (PRDM9 Human)
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPyPGK-EGFP-TM-IRES-Pac
Plasmid#183604PurposeMammalian expression vector for membrane-tethered EGFP from the mouse Pgk1 promoter. Confers puromycin resistance.DepositorInsertEGFP-TM
TagsHuman PDGFRB transmembrane domain and Mouse IgGK …ExpressionMammalianPromoterMouse Pgk1Available sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only