We narrowed to 3,248 results for: cat.3
-
Plasmid#82381PurposesgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMB3-B-TelR
Plasmid#204992PurposeLevel 3 MoClo plasmid for A. baumannii with additional Tellurite resistance cassette for multi-drug resistance strainsDepositorInsertmRFP1
UseSynthetic BiologyExpressionBacterialMutationAdded replications elements for Acinetobacter spe…Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM11-6xHis-TEV-hORF1p_K3AK4A
Plasmid#202585PurposeAllows for IPTG-inducible expression of the human L1RP ORF1 protein with the K3A and K4A mutations in bacteria with an N-terminal 6xHis tag and TEV cleavage site for purification with a minimal scarDepositorInsertORF1p
Tags6x His and TEV protease cleavage siteExpressionBacterialMutationChanged ORF1p Lysine 3 to Alanine, changed ORF1p …Available SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70LacZ8-CadR-Pcadh-LacZ
Plasmid#191623PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), Pcadh catechin dehydroxylase promoter-lacZ with transcriptional regulator CadRDepositorInsertlacZ
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_3
Plasmid#190702PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 3
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-OCT4-t2a-KLF4-e2a-SOX2-17-IRES-GLIS1
Plasmid#193356PurposeVEE-OKS*iG (self-replicating RNA vector expressing human OCT4 + KLF4 + super-SOX + GLIS1 + PuroR) for generation of integration-free iPSCsDepositorUseVenezuelan equine encephalitis (vee) virus rna re…ExpressionMammalianMutationSOX2-17 is engineered highly cooperative chimeric…Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-CTNNB1-Armadillo-HA
Plasmid#242224PurposeExpression of human β-catenin Armadillo repeats (deletion of a.a. 2-133 and a.a. 665-781) using piggyBac transpositionDepositorInsertCTNNB1 (CTNNB1 Human)
UsePiggybacTagsHAExpressionMammalianMutationDeleted N terminal and C terminal IDRs from β-cat…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-CTNNB1-deltaC-HA
Plasmid#242223PurposeExpression of human β-catenin ∆C terminal IDR (deletion of a.a. 665-781) using piggyBac transpositionDepositorInsertCTNNB1 (CTNNB1 Human)
UsePiggybacTagsHAExpressionMammalianMutationDeleted C terminal IDR from β-catenin (deletion o…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-CTNNB1-delta4-6-HA
Plasmid#242220PurposeExpression of human β-catenin ∆arm 4-6 (deletion of a.a. 268-394) using piggyBac transpositionDepositorInsertCTNNB1 (CTNNB1 Human)
UsePiggybacTagsHAExpressionMammalianMutationDeleted arm 4-6 from β-catenin (deletion of a.a. …PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only