We narrowed to 2,337 results for: CLU
-
Plasmid#166129PurposeExpression of human talin-1 head (aa1-405) in E. coli. Contains 37 amino acid deletion in F1-loop, replaced with Gly-Ala-Gly. N-terminal His6, Xpress-epitopeDLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(del37/GAG) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405, with 37 aa deletion in the F1-loop which…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsmEos2ExpressionMammalianMutationPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OKM
Plasmid#136554PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Klf4, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KSM
Plasmid#136553PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSM
Plasmid#136555PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, cMycDepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLViN-iRFP670-α-cateninA+ΔβH
Plasmid#229707PurposeLentiviral expression of iRFP670-alpha-cateninA+delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
t1-405(151-154AAAA)
Plasmid#166131PurposeExpression of human talin-1 head (aa1-405) in E. coli. Four substitutions in the F1-loop (aa151-154 all mutated to Al). N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(151-154AAAA) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405 only. Contains 4 amino acid substitutions…PromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a No Stop
Plasmid#84894PurposeDONOR vector for Gateway cloning of EWSR1 g1750a No StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationg1750a No StopPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1750a Stop
Plasmid#84893PurposeDONOR vector for Gateway cloning of EWSR1 g1750a StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationg1750aPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t Stop
Plasmid#84891PurposeDONOR vector for Gateway cloning of EWSR1 c1655t StopDepositorInsertEWSR1 (EWSR1 Human)
UseGateway donorTagsExpressionMutationc1655tPromoternoneAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_27
Plasmid#60307PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertC16orf80 enhancer (CFAP20 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_28
Plasmid#60308PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCRY2 enhancer (CRY2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_32
Plasmid#60311PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertDGKB enhancer (DGKB Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_36
Plasmid#60314PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertDNMT3A enhancer (DNMT3A Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_37
Plasmid#60315PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertARHGAP26 enhancer (ARHGAP26 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_38
Plasmid#60316PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertACSL1 enhancer (ACSL1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_39
Plasmid#60317PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertPCSK1 enhancer (PCSK1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_6
Plasmid#60255PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertGRM4 enhancer (GRM4 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_8
Plasmid#60257PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertKIRREL3 enhancer (KIRREL3 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_11
Plasmid#60260PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCDKAL1 enhancer (CDKAL1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_13
Plasmid#60261PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertEDN3 enhancer (EDN3 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_20
Plasmid#60266PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCDKN1C enhancer (CDKN1C Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_27
Plasmid#60270PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertC16orf80 enhancer (CFAP20 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_28
Plasmid#60271PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertCRY2 enhancer (CRY2 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_32
Plasmid#60274PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertDGKB enhancer (DGKB Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_36
Plasmid#60277PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertDNMT3A enhancer (DNMT3A Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_37
Plasmid#60278PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertARHGAP26 enhancer (ARHGAP26 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_39
Plasmid#60280PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertPCSK1 enhancer (PCSK1 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_10
Plasmid#60287PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorInsertLINGO2 inactive enhancer (LINGO2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_14
Plasmid#60290PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorInsertEDARADD inactive enhancer (EDARADD Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_5
Plasmid#60291PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertWSCD2 enhancer (WSCD2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_6
Plasmid#60292PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertGRM4 enhancer (GRM4 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_8
Plasmid#60294PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertKIRREL3 enhancer (KIRREL3 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_11
Plasmid#60297PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorInsertCDKAL1 enhancer (CDKAL1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_10
Plasmid#60250PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertLINGO2 inactive enhancer (LINGO2 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_14
Plasmid#60253PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertEDARADD inactive enhancer (EDARADD Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_5
Plasmid#60254PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertWSCD2 enhancer (WSCD2 Human)
UseEntry vectorTagsExpressionMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-p300 core
Plasmid#179553Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1G511A-CMyc
Plasmid#50734PurposeProduces lentivirus expressing human EWSR1G511A mutant with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 G511A (EWSR1 Human)
UseLentiviralTagsFLAG and MycExpressionMutationChanged Gly 511 to AlaPromoterTREAvailable sinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 c1222t No Stop
Plasmid#84900PurposeDONOR vector for Gateway cloning of TAF15 c1222t No StopDepositorInsertTAF15 (TAF15 Human)
UseGateway donorTagsExpressionMutationc1222t No StopPromoternoneAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
BIC-Gag-DDX3
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianMutationPromoterhCMVAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1WT-CMyc
Plasmid#50733PurposeProduces lentivirus expressing human EWSR1 wild type with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 (EWSR1 Human)
UseLentiviralTagsFLAG and MycExpressionMutationPromoterTREAvailable sinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-NFLAG-hEWSR1P552L-CMyc
Plasmid#50736PurposeProduces lentivirus expressing human EWSR1P552L mutant with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorInsertEWSR1 P552L (EWSR1 Human)
UseLentiviralTagsFLAG and MycExpressionMutationChanged Pro 552 to LeuPromoterTREAvailable sinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-CBP core
Plasmid#179556Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-CBP core
Plasmid#179555Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only