We narrowed to 2,443 results for: CLU
-
Plasmid#60313PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pGL4.23 C5_12
Plasmid#60319PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS C18orf26)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_14
Plasmid#60321PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS CCRN4L)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_7
Plasmid#60256PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSLC30A8 enhancer (SLC30A8 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_15
Plasmid#60262PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertFAM148A enhancer (C2CD4A Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_17
Plasmid#60263PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZFAND3 enhancer (ZFAND3 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_18
Plasmid#60264PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZBED3 enhancer (ZBED3 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_19
Plasmid#60265PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertTHADA enhancer (THADA Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_22
Plasmid#60267PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZMIZ1 enhancer (ZMIZ1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_26
Plasmid#60269PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertOBFC2A enhancer (NABP1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_29
Plasmid#60272PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertZFP36L2 enhancer (ZFP36L2 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_31
Plasmid#60273PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSLC2A2 enhancer (SLC2A2 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_34
Plasmid#60276PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertPNMA2 enhancer (PNMA2 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_8
Plasmid#60286PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_11
Plasmid#60288PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C2_13
Plasmid#60289PurposeThis plasmid contains a human pancreatic islet inactive enhancer, a minimal promoter and a luc2 gene.DepositorInsertSPATA19 inactive enhancer (SPATA19 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_15
Plasmid#60299PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_17
Plasmid#60300PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_18
Plasmid#60301PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_22
Plasmid#60304PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_8
Plasmid#60249PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertRAP1A inactive enhancer (RAP1A Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_11
Plasmid#60251PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSMYD3 inactive enhancer (SMYD3 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C2_13
Plasmid#60252PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertSPATA19 inactive enhancer (SPATA19 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1132
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 Stop
Plasmid#84895PurposeDONOR vector for Gateway cloning of TAF15DepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C5_15
Plasmid#60322PurposeThis plasmid contains a genomic fragment that is not active in human pancreatic islets, a minimal promoter and a luc2 gene. Can be used as negative control in reporter assays performed in human pancreatic islets.DepositorInsertNon active element (nearest TSS PHLDA1) (PHLDA1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSK
Plasmid#136552PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, Klf4DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 Stop
Plasmid#84887PurposeDONOR vector for Gateway cloning of EWSR1DepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-GenRep
Plasmid#214674PurposeMAPT Exon 10 reporter, with Exon 10 and 100bp flanking intronic regions replaced with a BamHI/EcoRI cloning site for testing different exonsDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9 and Exon 11, with a BamHI EcoRI c…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-SKM
Plasmid#136551PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Sox2, Klf4, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pK27Sumo_His-SUMO-nsp10-nsp16 fusion (SARS-CoV-2)
Plasmid#169191PurposeTo express nsp10-nsp16 fusion protein in E. coliDepositorInsert14His-SUMO-nsp10-GSGSGS-nsp16 (ORF1ab SARS-CoV-2, Synthetic)
Tags14His-SUMO and Fusion protein of SARS-CoV-2 nsp10…ExpressionBacterialMutationCodon optimised for E. coliPromoterT5Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 c1655t No Stop
Plasmid#84892PurposeDONOR vector for Gateway cloning of EWSR1 c1655t No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 g1532c No Stop
Plasmid#84890PurposeDONOR vector for Gateway cloning of EWSR1 g1532c No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_38
Plasmid#60279PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertACSL1 enhancer (ACSL1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-EWSR1 No Stop
Plasmid#84888PurposeDONOR vector for Gateway cloning of EWSR1 No StopDepositorAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_33
Plasmid#60275PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertGLIS3 enhancer (GLIS3 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_13
Plasmid#60298PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TAF15 No Stop
Plasmid#84896PurposeDONOR vector for Gateway cloning of TAF15 No StopDepositorAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_20
Plasmid#60303PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_33
Plasmid#60312PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
t206-405
Plasmid#166132PurposeFor expression of human talin-1 head fragment (residues 206-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-F2F3(206-405) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 206-405 onlyAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(del37/GAG)
Plasmid#166129PurposeExpression of human talin-1 head (aa1-405) in E. coli. Contains 37 amino acid deletion in F1-loop, replaced with Gly-Ala-Gly. N-terminal His6, Xpress-epitopeDLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(del37/GAG) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405, with 37 aa deletion in the F1-loop which…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-C1 PA-PLA1 (mEos2-PA-PLA1)
Plasmid#162878PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with mEos2 to perform sptPALMDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OKM
Plasmid#136554PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Klf4, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-KSM
Plasmid#136553PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Klf4, Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSM
Plasmid#136555PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, cMycDepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only