We narrowed to 19,813 results for: INO
-
Plasmid#87737PurposeBacterial expression of S. cerevisiae Vps4 AAA ATPase cassette fused to P. aeruginosa Hcp1DepositorInsertVacuolar protein sorting-associated protein 4 (VPS4 Budding Yeast)
Tags6xHis-V5-TEV and Hcp1ExpressionBacterialMutationdeleted amino acids 1-100PromoterT7Available SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast
Plasmid#61425Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)DepositorHas ServiceLentiviral PrepInsertdCAS9(D10A, N863A)-VP64_2A_Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-BiFC
Plasmid#87856PurposepETDUET-1 based vector for use in BiMolecular Fluorescence Complementation based assays. MCS at 5' of each BiFC fragment.DepositorInsertsEncodes for MCS & C-term half of mVenus
Encodes for MCS & N-term half of mVenus
TagsBiFC C-terminal fragmentExpressionBacterialPromoterT7Available SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mScarlet
Plasmid#131001PurposeAAV vector to drive the expression of mScarlet under the control of human Synapsin promoterDepositorHas ServiceAAV1 and AAV8InsertmScarlet
UseAAVPromoterhSynAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/mStayGold(c4)=UtrCH
Plasmid#212020PurposeFor filamentous actin labeling. Alternatively, the UtrCH gene can be replaced with a target gene for N-terminal tagging with mStayGold via a c4 adaptor and a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertUtrCH
TagsmStayGold(c4)ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(F74G)
Plasmid#140730PurposeOsTIR1(F74G)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(F74G)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET30a-SSDH
Plasmid#239573PurposeExpresses E. coli succinate semialdehyde dehydrogenase (SSDH/gabD) for recombinant protein purification. Contains a His6-tag on its C-terminus for Ni2+ affinity chromatography.DepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/F-tractin=mStayGold
Plasmid#212019PurposeFor filamentous actin labeling. Alternatively, the F-tractin gene can be replaced with a target molecule gene for C-terminal tagging with mStayGold through a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertF-tractin
TagsmStayGoldExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-hGSDME
Plasmid#218939PurposeExpression of N-terminal FLAG tagged human gasdermin EDepositorAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
FpG5
Plasmid#69443Purposelentiviral GFP reporter plasmid for high throughput functional detection of active transcriptional regulatory DNAsDepositorInsertsminimal FGF4 promoter
EGFP
Ubiquitin promoter
Hygromycin resistance
UseLentiviralExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pACT-HAB1_star
Plasmid#241277PurposeOrthogonal PYR1/HAB1 sensor moduleDepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR4GN (Lenti)
Plasmid#222693PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsGFPExpressionMammalianMutationPGK without BsmBI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_054
Plasmid#216096PurposeAll-in-one, knockout, delivers Cas12a & gRNADepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
4955 TRV2-eTnpBe-HHreRNA4PDS
Plasmid#251819PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertEnhanced variant of ISDra2 eTnpBe with guide targeting NbPDS flanked by HH-HDV ribozymes
TagsAtFDnlsExpressionPlantMutationL172G/V192L/L222I/P282V/I304RAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO human ULK1 shRNA 8
Plasmid#27633DepositorInserthuman ULK1 shRNA 8
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceMarch 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBa.MARK2-Halo
Plasmid#224414PurposeMammalian expression of MARK2DepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-NanoBondy 2H5(R72C)
Plasmid#247051PurposeFor expression of covalently reactive anti-CD45 2H5-derived NanoBondy (R72C clamp site, 9 residue linker) in bacterial cytoplasmDepositorInsertNanoBondy 2H5(R72C)-Ctag
TagsC-tag and SpyTag003ExpressionBacterialPromoterT7 promoterAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC-GFP-AT
Plasmid#133306Purpose"Burdensome" GFP expressing plasmid carrying axe/txe toxin-antitoxin for plasmid stabilisationDepositorInsertaxe/txe toxin-antitoxin cassette
UseSynthetic BiologyExpressionBacterialAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only