We narrowed to 14,166 results for: TIM;
-
Plasmid#171997PurposeSequence provided for PE-Nuclease mRNA transcription, suitable for microinjectionDepositorInsertCMV_T7-Cas9-RT
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-HA-CAD S1859A
Plasmid#46239PurposeFLAG-HA-CAD with S1859 phosphorylation site mutated to alanineDepositorInsertcarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad Mouse)
TagsFLAG and HAExpressionMammalianMutationSerine 1859 changed to Alanine (S1859A)PromotercmvAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CLK1
Plasmid#174088PurposeInducibly expresses Myc-CLK1 in mammalian cells with the Tet-on systemDepositorAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001145369)
Plasmid#76141Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-pNFkB::Cre-mRuby3
Plasmid#164137PurposeLentiviral construct for building stable cell lines expressing Cre recombinase and mRuby3 in the presence of TNFaDepositorInsertNFkB promoter-Cre-T2A-mRuby3
UseCRISPR, Cre/Lox, Lentiviral, and Synthetic Biolog…ExpressionMammalianPromoterNFkB synthetic promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148607)
Plasmid#76363Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-HF1-P2A-EGFP (RTW3505)
Plasmid#139995PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-HF1(N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationHF1=N497A/R661A/Q695A/Q926APromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYTSK01K_0G7
Plasmid#177296Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmRDepositorInsertPaacC1-aacC1
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
PKD1 gRNA (BRDN0001149263)
Plasmid#76843Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpG-PPE
Plasmid#170130PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertnCas9-SpG(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T1…Promotermaize Ubiquitin-1Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CAD
Plasmid#73566PurposeSoluble red fluorescent activator of Orai1 channelsDepositorInsertmCherry-CAD (STIM1 342-448) (STIM1 Human, Synthetic)
Tags6x His and mCherryExpressionMammalianPromoterCMV Immediate EarlyAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68717PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterCAG-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD86-SmBiT
Plasmid#223618PurposeLentiviral expression of human CD86 with SmBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRKCE gRNA (BRDN0001148049)
Plasmid#76791Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-oROS-HT
Plasmid#216416PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the extracellular site of cell membranes.DepositorInsertpDisplay-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-GFP(1-10)opti
Plasmid#129416PurposeExpressing codon-optimized GFP(1-10) fragment in human cellsDepositorInsertcodon-optimized GFP(1-10)
UseCRISPR, TALEN, and Unspecified ; Human safe harbo…ExpressionMammalianPromoterEF-1αAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-rM1PYK
Plasmid#220232PurposeInducible expression of rabbit muscle pyruvate kinase isoform 1DepositorAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only