We narrowed to 5,873 results for: org
-
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Dok1-V2
Plasmid#215452PurposeExpression vector with Dok1 tagged with the BiFC V2 fragmentDepositorAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHW1387
Plasmid#229880PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses - Pmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1392
Plasmid#229878PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses- Psnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPsnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1391
Plasmid#229877PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses - Psnt-1::HisCl1 cDNA::SL2::mScarlet-I-C1::tbb-2 3'UTRDepositorInsertPsnt-1::HisCl1 cDNA::SL2::mScarlet-I-C1::tbb-2 3'UTR
TagsmScarlet-I-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S-FHA-SpAGO4a_gDNA
Plasmid#216841PurposeN-term Flag-HA tagged Spirodela polyrhiza (Sp9509) AGO4a gDNA under regulation of CaMV 35S promoterDepositorInsertARGONAUTE4
TagsFlag-HAExpressionPlantPromoterCaMV 35SAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S-FHA-SpAGO4a_cDNA
Plasmid#216842PurposeN-term Flag-HA tagged Spirodela polyrhiza (Sp9509) AGO4a cDNA under regulation of CaMV 35S promoterDepositorInsertARGONAUTE4
TagsFlag-HAExpressionPlantPromoterCaMV 35SAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ZGLP1
Plasmid#222926PurposePiggyBac transposon plasmid for doxycycline inducible expression of ZGLP1DepositorInsertZGLP1 (ZGLP1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERH-SOHLH1
Plasmid#222922PurposePiggyBac transposon plasmid for doxycycline inducible expression of SOHLH1DepositorInsertSOHLH1 (SOHLH1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFBP-2_6m.mutant
Plasmid#162842PurposeYeast expression of the mutant #2_6m for the RNA-based sensor of fructose-1,6-bisphosphate #2_6DepositorInsert2_6m_RNA-device
ExpressionYeastAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_3
Plasmid#36376DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD4_2
Plasmid#36375DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only