We narrowed to 4,289 results for: Mcc;
-
Plasmid#75165PurposeLentiCRISPR-EGFP with sgRNA targeting human RIP3DepositorInsertRIP3 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAIP hGMCSF co
Plasmid#74168PurposeLentiviral vector for expression of human codon optimized GMCSF with puromycin resistance.DepositorAvailable SinceJune 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
StrKDEL-IRES_mScarleti_Sec23A
Plasmid#117273PurposeExpresses an Str-KDEL Hook for the RUSH system and separately mScarleti-Sec23ADepositorInsertsTagsmScarlet-iExpressionMammalianMutationHuman Sec23A; Sequencing showed a mutation in Sec…PromoterCMV and IRESAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP 5'CMV Δtat ΔTARx2_d2TetOp
Plasmid#101349Purpose2xTet Operator inserted between NFkB and Sp1 sites in U3 of HIV-1 delta tat with 5' CMV-R-U5. 5' and 3' TAR elements were mutated to: 5'-GGTCTCTCTGGTTAGACCAGAAAGGAGCATTGGAGCTCTCTGGCTAACTAGGGAACCC-3DepositorInsertNL4-3
UseLentiviralMutationdelta tat delta TAR delta env GFP in Nef Tet ope…Available SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry2-sgMUC4
Plasmid#198399PurposeExpresses a guide RNA against a repetitive locus found in the MUC4 gene of human chromosome 3, with mCherry2 reporterDepositorAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-EGFP-RIP1
Plasmid#75163PurposeLentiCRISPR-EGFP with sgRNA targeting human RIPk1DepositorInsertRIPK1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
DDX5 D248N V5
Plasmid#199577PurposeExpresses helicase dead DDX5 cloned into pLenti puroDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (0)-(4) sites mutant pGL3Basic
Plasmid#32737DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseMutation-539 TCF(0) ATGAAAG deletion; -75 TCF(1) and -68 …Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
TRE-eGFP-F1C
Plasmid#211457PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation blocking peptide (F1C)DepositorInsertFlotillin-1-palmitoylation blocking peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationNoneAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE-eGFP-F1A
Plasmid#211458PurposeDox inducible delivery of eGFP fused to a flotillin-1 palmitoylation mutant control peptide (F1A)DepositorInsertFlotillin-1-palmitoylation mutant control peptide (FLOT1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationC34AAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP 5'CMV Δtat
Plasmid#101347Purposetat ATG->ACG (silent in vpr reading frame), nt 78 mutated T->G to change Tyr to stop codon, nt 116 mutated T->C to disrupt Met, 5'LTR replaced with CMV-R-U5 from pALPS for tat-independent transcription in HEK293E cells.DepositorInsertNL4-3
UseLentiviralMutationdelta TatAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(4) sites mutant pGL3Basic
Plasmid#32736DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pWHI2-NAT
Plasmid#80588PurposeCEN plasmid expressing full-length WHI2 from S.cerevisiae S288C background under its native promoterDepositorAvailable SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo E321K ORF29
Plasmid#200025PurposeLentiviral vector for expression of KSHV ORF29 with E321K mutationDepositorInsertORF29
UseLentiviralMutationGlutamic acid 321 changed to lysinePromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo G226A E321K ORF29
Plasmid#200026PurposeLentiviral vector for expression of KSHV ORF29 with G226A and E321K mutationDepositorInsertORF29
UseLentiviralMutationGlycine 226 changed to alanine, glutamic acid 321…PromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-zeo D476A ORF29
Plasmid#200027PurposeLentiviral vector for expression of KSHV ORF29 with D476A mutationDepositorInsertORF29
UseLentiviralMutationAspartic acid 476 changed to AlaninePromoterCMVAvailable SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
StrKDEL-IRES-ManII-mScarlet-i
Plasmid#117274PurposeExpresses an Str-KDEL Hook for the RUSH system and separately mannosidase II-mScarlet-iDepositorInsertsTagsmScarlet-iExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMV and IRESAvailable SinceJan. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
Plasmid#194279PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vectorDepositorInsertshumanized VP64 dSaCas9 VP64 T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4C (216-233) (pGEX2T(TEV))
Plasmid#80635PurposeResidues 216-233 of CHMP4C; Bacterial Expression Vector; TEV-cleavable GST tag; Sundquist Lab Internal ID: WISP06-202DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only