We narrowed to 27,298 results for: sta
-
Plasmid#211363PurposeMammalian expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionMammalianMutationE138DPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Histag-mCherry (527)
Plasmid#70719PurposeExpression vector for mCherry purificationDepositorInsertmCherry
Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSIH1-puro-STAT3 shRNA
Plasmid#26596DepositorInsertSTAT3 shRNA (STAT3 Human)
UseLentiviral and RNAiAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro
Plasmid#227256PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a mStayGold-EFS-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Blast
Plasmid#227257PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a mStayGold-EFS-Blast cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Zeo
Plasmid#227258PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a mStayGold-EFS-Zeo cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Stat3-C Flag pRc/CMV
Plasmid#8722DepositorInsertStat3-C (Stat3 Mouse)
TagsFlagExpressionMammalianMutationA662C and N664C. Residues changed to Cys renders…Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TUBA1B
Plasmid#227327PurposeDonor template for mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a mStayGold Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-ACTB
Plasmid#227320PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a Puro-2A-mStayGold Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant mNG-ORP8
Plasmid#195170Purposemammalian expression of siRNA-resistant ORP8 tagged with mNeonGreenDepositorInsertORP8 (OSBPL8 Human)
TagsmNeonGreenExpressionMammalianMutationWobble mutations for siRNA resistance from K174 t…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-ACTB
Plasmid#227326PurposeDonor template for mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorInsertACTB Homology Arms flanking a mStayGold Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV-IL13-CD8aStalk-PDGFR
Plasmid#240242PurposeLentiviral transfer plasmid encoding IL13 with CD8a stalk and PDGFR TM domainDepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsStaufen2-T1_V
Plasmid#147741PurposeMammalian Expression of HsStaufen2-T1DepositorInsertHsStaufen2-T1 (STAU2 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
Venus2-Y705F/S727A-STAT3
Plasmid#123177PurposeExpresses Y705F/S727A STAT3 double mutant fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
TagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationDouble Y705F and S727A substitutionsAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-Y705F/S727A-STAT3
Plasmid#123176PurposeExpresses Y705F/S727A STAT3 double mutant fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationDouble Y705F and S727A substitutionsAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFL-SV40-STAT1 5'-UTR
Plasmid#115353Purposefirefly luciferase (Fluc) reporter containing the 5’-UTR of STAT1DepositorInsertSTAT1 5'-UTR (STAT1 Human)
Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only