We narrowed to 28,479 results for: sta
-
Plasmid#86383PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster ham enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-sgl
Plasmid#86384PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster sgl enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-ncm
Plasmid#86385PurposeVector to measure enhancer responsiveness of candidates from a genomic library (cloned instead of the core promoter) by determining the abundance of transcripts originating from each candidate.DepositorInsertD. melanogaster ncm enhancer
UseStap-seq screening vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTAP-seq_fly-zfh1_spikeIn-2
Plasmid#86388PurposeExpression vector for a transcript origination from a D. pse core promoter, which is used as trasfection control (normalization), i.e. STAP-seq screening vector containing one specific core promoterDepositorInsertD. melanogaster zfh1 enhancer & D. pseudoobscura CG32369 core promoter
UseStap-seq spike in vectorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSTARR-seq_fly-x16
Plasmid#71505PurposeflySTARR-seq screening vector with x16 core promoterDepositorTypeEmpty backboneUseFlystarr-seq screening vectorTagssgGFP (SuperGlo, Qbiogene, Inc)ExpressionInsectAvailable SinceFeb. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSTARR-seq_fly-eEF1delta
Plasmid#71501PurposeflySTARR-seq screening vector with eEF1delta core promoterDepositorTypeEmpty backboneUseFlystarr-seq screening vectorTagssgGFP (SuperGlo, Qbiogene, Inc)ExpressionInsectAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Notothenia angustata cryaa
Plasmid#47666PurposeRecombinant protein productionDepositorInsertAlpha A-crystallin
ExpressionBacterialPromoterT7Available SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL(AAA)
Plasmid#25063DepositorInsertBimL (AAA) (BCL2L11 Human)
TagsGstExpressionBacterialMutationChanged serine 44 to alanine Changed threonine 5…Available SinceAug. 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL (S44A)
Plasmid#24252DepositorInsertBimL(S44A) (BCL2L11 Human)
TagsGstExpressionBacterialMutationChanged Serine 44 to AlanineAvailable SinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL (T56A)
Plasmid#24253DepositorInsertBimL(T56A) (BCL2L11 Human)
TagsGSTExpressionBacterialMutationChanged threonine 56 to alanineAvailable SinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimL (S58A)
Plasmid#24254DepositorInsertBimL(S58A) (BCL2L11 Human)
TagsGstExpressionBacterialMutationChanged serine 58 to alanineAvailable SinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGSTag BimEL (3SA)
Plasmid#23100DepositorInsertBim EL (3SA) (Bcl2l11 Mouse)
TagsGSTExpressionBacterialMutationchanged Serine 55/65/73 to alanineAvailable SinceFeb. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Histag-mCherry (527)
Plasmid#70719PurposeExpression vector for mCherry purificationDepositorInsertmCherry
Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-10His-mStayGold (E138D)
Plasmid#211363PurposeMammalian expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionMammalianMutationE138DPromoterCMVAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-STAT6-IRES-Neo
Plasmid#35482DepositorAvailable SinceApril 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant mNG-ORP8
Plasmid#195170Purposemammalian expression of siRNA-resistant ORP8 tagged with mNeonGreenDepositorInsertORP8 (OSBPL8 Human)
TagsmNeonGreenExpressionMammalianMutationWobble mutations for siRNA resistance from K174 t…PromoterCMVAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro
Plasmid#227256PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a mStayGold-EFS-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11
Plasmid#227332PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only