We narrowed to 855 results for: tdTomato
-
Plasmid#134308PurposeExpresses Synaptophysin-TdTomato and also tamoxifen dependant Cre (OHT-Cre, aka Cre-ER)DepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pAW8_tdTomato
Plasmid#110239PurposeCre/Lox C-terminal tagging construct encoding red fluorescent protein tdTomatoDepositorTypeEmpty backboneUseCre/LoxAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SOX17-NLS-tdTomato-EPG
Plasmid#210466PurposeDonor plasmid for knock-in NLS-tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived puromycin-EGFP selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmTol-InsUAS-6MTnlstdTomato2A-Dusp6DM-CC
Plasmid#67687PurposeUAS-driven 6xMyc nuclear localized tdTomato-2A-activated Dusp6 in minTol backbone; also with cry:cfp cassetteDepositorAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-tdTomato
Plasmid#106949PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with tdTomato markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
CaYin1
Plasmid#33067DepositorInsertCaYin1
Tags6 His tagExpressionBacterialPromoterARA promoterAvailable SinceJan. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDRF1-GW ytdtomato-T2A-mTurquoise2
Plasmid#118451PurposeProduces equimolar expression of yeast codon-optimized tdTomato and mTq2DepositorInsertytdtomato-T2A-mTurquoise2
ExpressionYeastAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CARMIL2 BH domain-tdTomato
Plasmid#118737PurposeTo express CARMIL2 tagged BH with tdTomato on C-terminusDepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
QUAS-jGCaMP7s-T2A-tdTomato
Plasmid#200010PurposeQUAS reporter line expressing GCaMP7s calcium indicator and tdTomato, separated by T2ADepositorInsert3xP3-ECFP-jGCaMP7s-td-Tomato
ExpressionInsectAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG::TdTomato
Plasmid#140504PurposeEncodes TdTomato driven by the CAG promoterDepositorInsertCAG promoter
UseChicken expressionExpressionMammalianAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-myr-tdTomato-SV40pA-FKF
Plasmid#119867PurposeDonor cassette containing myr-tagged tdTomato and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertmyr-tagged tdTomato and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
Tags2x myristoylationExpressionBacterialAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
SNV-memTdTomato
Plasmid#53123Purposeretroviral vector expressing membrane TdTomato, driven by the Spleen Necrosis Virus promoter; for use in chicken cellsDepositorInsertmemTdTomato
UseRetroviral; Expression in chicken cellsPromoterSNV (spleen necrosis virus)Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-tdTomato-sg
Plasmid#194722PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chx10 (2.5kb distal 5' reg)+SV40p-tdTomato-IRES-AP
Plasmid#18814DepositorInsertChx10 (2.5kb distal 5' reg)+SV40p-tdTomato-IRES-AP
ExpressionMammalianAvailable SinceAug. 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
AiP1205-Ai227 (TICF-nls-EGFP-ICF-tdTomato-WPRE)
Plasmid#181761Purposetargeting vectorDepositorInsertnls-tagged EGFP and tdTomato
ExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-nl.EGFP-tdTomato
Plasmid#172382PurposeProduction of RVdG-CVS-N2c viral vectors for cell-type specific trans-synaptic retrograde labeling.DepositorInsertnuclear-localized EGFP + tdTomato
UseNeurotropic virusAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaYin1 NES
Plasmid#33318DepositorInsertCaYin1 NES
TagsNES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBT267_(pCA-ATG-intron-tTA2-TRE-tdT3Myc)
Plasmid#36879DepositorInsertstTA2
tdT-3Myc
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only