We narrowed to 8,324 results for: gnal
-
Plasmid#209920PurposeMammalian expression of cRaf fused to miRFP703-eDHFR(69K6)DepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pPBbsr2-miRFP703-eDHFR(69K6)-cRaf
Plasmid#209921PurposeMammalian expression of cRaf fused to miRFP703-eDHFR(69K6)DepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-HBEGF-ScNeo
Plasmid#209903PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertHBEGF-ScNeo (HBEGF Human)
UseTagsmNeonGreen and mScarletExpressionMammalianMutationPromoterAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-EREG-ScNeo
Plasmid#209905PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-HBEGF-ScNeo
Plasmid#209907PurposeTo monitor the status of HB-EGF, the plasmid encodes a recombinant HB-EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertHBEGF-ScNeo (HBEGF Human)
UseTagsmNeonGreen and mScarletExpressionMammalianMutationPromoterAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 7 deletion
Plasmid#224388PurposeLenti plasmid for generating GNB1L _WD 7 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationWD 7 domain deleted (aa 286-323)PromoterAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 6 deletion
Plasmid#224387PurposeLenti plasmid for generating GNB1L _WD 6 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationWD 6 domain deleted (aa 242-282)PromoterAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 4 deletion
Plasmid#224385PurposeLenti plasmid for generating GNB1L _WD 4 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
UseTagsExpressionBacterial and MammalianMutationWD 4 domain deleted (aa 153-195)PromoterAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-3xHA-hM3D(Gq)-P2A-ArgiNLS-oScarlet
Plasmid#220614PurposeCre-dependent co-expression of 3x HA-tagged excitatory hM3D(Gq) DREADD receptor, and a single-cell discriminating version of oScarlet as a reporter.DepositorInsert3x HA-hM3D(Gq)-P2A-AgiNLS-oScarlet
UseAAV and Cre/LoxTags3x HA; ArgiNLSExpressionMammalianMutationPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57-Cx32D178Y-IRES-GCaMP6s
Plasmid#216796PurposeInducible bicistronic lentiviral plasmid for the simultaneous expression of the D178Y mutant form of Connexin 32 and cytosolic GCaMP6sDepositorInsertCx32D178Y-IRES-GCaMP6s (GJB1 Human)
UseLentiviralTagsExpressionMutationD178Y mutant form of Connexin 32PromoterAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS WT-HA-GFP
Plasmid#199687PurposeExpression of LYCHOS WT in insect cellsDepositorInsertLYCHOS (GPR155 Human)
UseTags10xHis, EGFP, HA, HRV 3C, and HisExpressionInsectMutationPromoterAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) ∆DEP-HA
Plasmid#199683PurposeTransient expression of LYCHOS (GPR155) ∆DEP-HADepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationDEP domain deletedPromoterCMVAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5 LYCHOS (GPR155) Y551A-HA
Plasmid#199676PurposeTransient expression of LYCHOS (GPR155) Y551A mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationY551 mutated to APromoterCMVAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28a LZ LED WT-FLAG
Plasmid#199679PurposeBacterial expression of Leucine Zipper (LZ) LYCHOS LED-FlagDepositorInsertLeucine zipper LYCHOS LED WT (GPR155 Human)
UseTags6xHis and FlagExpressionBacterialMutationPromoterT7 promoterAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) P44A-HA
Plasmid#199675PurposeTransient expression of LYCHOS (GPR155) P44A mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationP44 mutated to APromoterCMVAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) E48Q-HA
Plasmid#199662PurposeTransient expression of LYCHOS (GPR155) E48Q mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationE48 mutated to QPromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) F43I-HA
Plasmid#199674PurposeTransient expression of LYCHOS (GPR155) F43I mutantDepositorInsertGPR155 (GPR155 Human)
UseTagsHAExpressionMammalianMutationF43 mutated to IPromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35A
Plasmid#197562PurposeMammalian expression of myc-tagged human Nix with an alanine substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
UseTagsMycExpressionMammalianMutationSerine 35 changed to alaninePromoterCMVAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix-S35D
Plasmid#197563PurposeMammalian expression of myc-tagged human Nix with an aspartic acid substitution of serine-35. Based on Myc-Nix (#100795)DepositorInsertBCL2 interacting protein 3 like (BNIP3L Human)
UseTagsMycExpressionMammalianMutationSerine 35 changed to aspartic acidPromoterCMVAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only