We narrowed to 9,581 results for: plat
-
Plasmid#221082PurposePlasmid for producing DNA Templates for in vitro transcription. Produces msfGFP[r5M] and mEBFP2 from IVT mRNA.DepositorInsertACC-msfGFP[r5M]_ACC-mEBFP2
UseSynthetic BiologyPromoterCMV, T7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_NPM2-T2A-mGreenLantern-PuroTK
Plasmid#222910PurposeHomology directed repair template for knocking in mGreenLantern reporter to NPM2.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR_FIGLA-T2A-mGreenLantern-PuroTK
Plasmid#222905PurposeHomology directed repair template for knocking in mGreenLantern reporter to FIGLA.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHDR2_TFAP2C-T2A-mGreenLantern-Hygro
Plasmid#222915PurposeHomology directed repair template for knocking in mGreenLantern reporter to TFAP2C.DepositorInsertmGreenLantern
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTAFR-DuET
Plasmid#213368PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, pai…Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.6RT4-Pct5.1-crRNA(hcdR)-RT(ΔhcdR)
Plasmid#191646PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(hcdR-targeting spacer) hcdR-deleting repair template, used for hcdR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-CR-PA
Plasmid#175445PurposeHiFi-compatible destination vector for secreted overexpression of thrombin-cleavable, C-terminal Protein A tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTagsBiP Secretion Peptide and Thrombin-Protein AExpressionInsectPromoterFused Actin-HSP70Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(-)-TOMM20-dTomato
Plasmid#115922Purposedonor to insert dTomato at the TOMM20 locus in human cellsDepositorInsertTOMM20-dTomato
UseDonor templateTagsdTomatoAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(+)-GAPDH-IRES-dTomato
Plasmid#115912Purposedonor to insert IRES-dTomato at the GAPDH locus in human cellsDepositorInsertIRES-dTomato
UseDonor templateTagsdTomatoAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUT1760-HQ858774
Plasmid#27856DepositorInsertPLATZ transcription factor from DV170419
UseEntry vectorAvailable SinceMarch 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF3549
Plasmid#145025PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens. This is the control vector for the collection.DepositorInsertGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX_305_Ovalbumin
Plasmid#184924PurposeLentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.DepositorInsertOvalbumin (OVAL Chicken)
UseLentiviralExpressionMammalianMutationOur vector has an A188T mutation that does not im…PromoterPGKAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0172
Plasmid#142551PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2768
Plasmid#142159PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2910
Plasmid#143665PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0477
Plasmid#144359PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX317-RBFOX1
Plasmid#115442PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only