We narrowed to 35,138 results for: LAT
-
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 S. pyogenes, Synthetic, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2/DEST/hCx43-E2HA-stop
Plasmid#40909DepositorInsertConnexin 43 internal HA tag (GJA1 Human)
ExpressionMammalianMutationHA tag inserted in second extracellular loopPromoterCMVAvailable SinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.Flag.HERC2-HECT-C4762A.6xHis
Plasmid#39228DepositorInsertHERC2 HECT Domain (HERC2 Human)
Tags6xHis and FlagExpressionMammalianMutationC4762APromoterT7Available SinceJuly 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pQCXIN- myc ULK1 wt
Plasmid#27626DepositorInsertmouse myc ULK1 (Myc Mouse)
UseRetroviralTagsmycMutationInitial M from ULK1 removed. Silent mutation at A…Available SinceApril 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDSG320
Plasmid#115597Purposesurface-displayed Nb2, used in composability experiments; medium copyDepositorInsertregulated adhesin construct
ExpressionBacterialAvailable SinceOct. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXP842
Plasmid#46068DepositorTypeEmpty backboneExpressionYeastPromoterADH2Available SinceSept. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_Gq_dTomato
Plasmid#213832PurposeAAV construct expressing HA-hM3Dq-dTomato driven by cholinergic neuron-targeting enhancer. Alias: pAAV_S9E27_Gq_dTomatoDepositorInsertHA-GqDREADD-dTomato
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNA500
Plasmid#149576Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIYC04
Plasmid#64741PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEPkan-S2
Plasmid#61601PurposePCR template for en passant (two-step Red-mediated) mutagenesisDepositorInsertKana_I-SceI
Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSII314
Plasmid#35451DepositorTypeEmpty backboneUseYeast centromere vectorPromoterNoneAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-3xflagGREB1a
Plasmid#112221Purposemammalian expression of flag tagged GREB1aDepositorAvailable SinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 T7 Bmf
Plasmid#24257DepositorAvailable SinceJune 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLNC Wnt-3
Plasmid#17993DepositorInsertWnt-3 (WNT3 Human)
UseRetroviralAvailable SinceJuly 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_Empty
Plasmid#221480PurposeEmpty vector control for pLX307 overexpresion experimentsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP
Plasmid#65521PurposePlasmid for the generation of GFP-knockin fusions via Bxb1-mediated recombination into MIN-tagged cell linesDepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaoB
Plasmid#196052PurposeEncodes a G alpha subunit (GNAO1 Isoform Alpha 2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensorDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PRKAR2A
Plasmid#20601DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only