We narrowed to 10,197 results for: otos
-
Plasmid#136362PurposeBacterial expression of recombinant Arabidopsis thaliana GUN1 (amino acids 781 to 918)DepositorInsertcDNA of Arabidopsis thaliana GUN1 corresponding to amino acids 781 to 918 (GUN1 Mustard Weed)
TagsTRX-HisExpressionBacterialPromoterT7Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET48 AtGUN1-PPR1
Plasmid#136359PurposeBacterial expression of recombinant Arabidopsis thaliana GUN1 (amino acids 232 to 708)DepositorInsertcDNA of Arabidopsis thaliana GUN1 corresponding to amino acids 232 to 708 (GUN1 Mustard Weed)
TagsTRX-HisExpressionBacterialPromoterT7Available SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET48 AtGUN1-PPR2
Plasmid#136360PurposeBacterial expression of recombinant Arabidopsis thaliana GUN1 (amino acids 232 to 619)DepositorInsertcDNA of Arabidopsis thaliana GUN1 corresponding to amino acids 232 to 619 (GUN1 Mustard Weed)
TagsTRX-HisExpressionBacterialPromoterT7Available SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
Plasmid#141236PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertNES-jRGECO1a
UseAAV and Cre/Lox; Cre-offTags6xHIS tag and nuclear export signalPromoterhuman elongation factor-1 alpha (EF-1 alpha)Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAC-TMPRSS2
Plasmid#158385PurposeMAC-tagged gene expressionDepositorAvailable SinceAug. 26, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel)
Plasmid#40347DepositorInsertBCL-6 ZFΔ (BCL6 Human)
ExpressionMammalianMutationContains aa1-504; ZF domain deleted (see note bel…PromoterpCAGAvailable SinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-myc-LC3(G120A)-HA
Plasmid#45245DepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagsHA and mycExpressionMammalianMutationGlycine at position 120 mutated to AlanineAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFIa-DIO-LMO7 (mNeonGreen-eKL9h-VChR1)
Plasmid#205098PurposeCre-dependent fusion protein of mNeonGreen, eKL9h, and Volvox channelrhodopsin-1 (luminopsin LMO7) for bioluminescent optogeneticsDepositorInsertmNeonGreen, eKL9h, and Volvox channelrhodopsin-1
UseAAVPromoterhSynAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSET-pr-mKikGR1 (mKikGR1-V69T)
Plasmid#99227PurposeBacterial expression of the primed conversion capable protein pr-mKikGR1 (mKikGR1-V69T).DepositorInsertpr-mKikGR1
ExpressionBacterialMutationmonomeric variant with mutation V69T (Eos notatio…PromoterT7Available SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-mApg5(K130R)
Plasmid#22959DepositorInsertautophagy related genes 5 (Atg5 Mouse)
TagsEGFPExpressionMammalianMutation130 Lysine to ArginineAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Cx32-7
Plasmid#54054PurposeLocalization: Gap Junctions, Excitation: 487, Emission: 509DepositorAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCerulean3-MAPTau-C-10
Plasmid#55431PurposeLocalization: Microtubules, Excitation: 433, Emission: 475DepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNAIIIB rac1 QL
Plasmid#61633Purposemammalian expression of rac1 constitutively active mutantDepositorAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-Mac-GFP
Plasmid#58852PurposeAAV-mediated expression of Mac-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertMac-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-GRAB_g5-HT3.0mut
Plasmid#208724PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0mut in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0mut
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEE062
Plasmid#176819PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert701
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only