We narrowed to 49,050 results for: prot
-
Plasmid#27065DepositorInsertP#38-luxAB integrative
ExpressionBacterialAvailable SinceMay 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Myc-TRF2ZNF1-11
Plasmid#87178PurposeRetroviral stable expression of chimeric protein TRF2ZNF1-11DepositorInsertchimeric protein TRF2ZNF1-11
UseRetroviralTagsMycExpressionMammalianPromoterCMVAvailable SinceMarch 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc4-CBPDHFR
Plasmid#63990PurposePosition 4 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTagsCalmodulin Binding Peptide (CBP)ExpressionBacterialPromoterT7Available SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCri-16a
Plasmid#61324PurposeProtein expression.DepositorInsertGreen fluorescent protein
TagsHis-tagExpressionBacterialAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCri-14a
Plasmid#61322PurposeProtein expression.DepositorInsertGreen fluorescent protein
TagsHis-tag and LSL-tagExpressionBacterialAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCri-8a-Strep
Plasmid#61340PurposeProtein expression.DepositorInsertGreen fluorescent protein
TagsHis-tag and Strep-tagExpressionBacterialAvailable SinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pNH043
Plasmid#42155DepositorInsertmTFP1
Available SinceFeb. 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTE-0X38-GCT6
Plasmid#27057DepositorInsertP#38-gfp-DAS+4
ExpressionBacterialAvailable SinceMay 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLIC.B3.TM1734
Plasmid#11527DepositorAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
HA_DD-N-mScarlet-I-QtSig
Plasmid#236775PurposeExpresses the red fluorescent protein mScarlet-I fused to the encapsulation signal for QtEnc and fused to a degron signal for proteasomal degradation when not encapsulated.DepositorInsertHA_DD-N_mScarlet-I_QtSig
ExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA_DD-N-mTagBFP2-QtSig
Plasmid#236776PurposeExpresses the blue fluorescent protein mTagBFP2 fused to the encapsulation signal for QtEnc and fused to a degron signal for proteasomal degradation when not encapsulated.DepositorInsertDD-N, TagBFP, QtSig
ExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaNL
Plasmid#216911PurposeMega' with knockout of GvpN and GvpLDepositorInsertMega' with knockout of GvpN and GvpL
ExpressionBacterialAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaRLS
Plasmid#216955PurposeMega' with knockout of GvpR, GvpL and GvpSDepositorInsertMega' with knockout of GvpR, GvpL and GvpS
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLT
Plasmid#216933PurposeMega' with knockout of GvpL and GvpTDepositorInsertMega' with knockout of GvpL and GvpT
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaJU
Plasmid#216943PurposeMega' with knockout of GvpJ and GvpUDepositorInsertMega' with knockout of GvpJ and GvpU
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaKJ
Plasmid#216939PurposeMega' with knockout of GvpK and GvpJDepositorInsertMega' with knockout of GvpK and GvpJ
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST39-Mega'-deltaLSK
Plasmid#216957PurposeMega' with knockout of GvpL, GvpS and GvpKDepositorInsertMega' with knockout of GvpL, GvpS and GvpK
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJB75
Plasmid#226320PurposeE. coli protein expression for protein purificationDepositorInsert6xHis-(Y to A MR1-6)-strep
Tags6xHis and StrepExpressionBacterialMutationN-terminal domain deleted, C-terminal domain deleā¦PromoterT7Available SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only