We narrowed to 13,640 results for: cdna
-
Plasmid#199627PurposeEucaryotic expression plasmid for chimeric cytokine of IL-11 and LIF (GIL-11) with a TwinStrep-tagDepositorInsertGIL-11
TagsTwinStrep-tagExpressionMammalianPromoterT7Available SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
1099 pcDNA GFP FKHR AAA
Plasmid#9023DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-RNF168 delta RING
Plasmid#133982Purposemammalian expression vector of Flag tagged RNF168 where the N-terminus of RNF168 has been deleted (including RING domain)DepositorAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-Flag-RNF168 delta MIU1
Plasmid#133978Purposemammalian expression vector of Flag tagged RNF168 where the first motif interacting with ubiquitin (MIU) has been deletedDepositorAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1 FLAG-SIV-MAC251-vpx
Plasmid#115842PurposeEncodes codon optimized FLAG tagged SIVMAC251-VpxDepositorInsertSIVMAC251-Vpx
Tags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-RNF168 delta MIU2
Plasmid#133979Purposemammalian expression vector of Flag tagged RNF168 where the second motif interacting with ubiquitin (MIU) has been deletedDepositorAvailable SinceNov. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1(+)-Lifeact-(GGS)X6-HaloTag C58
Plasmid#171435PurposeExpression of Lifeact-(GGS)X6-HaloTag C58 in mammalian cellsDepositorInsertLifeact-(GGS)X6-HaloTag C58
ExpressionMammalianAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/AUG-nLuc-3XFLAG-PEST
Plasmid#127312PurposeExpress 3xFLAG tagged destabilized nanoLuciferase (nLuc) protein from AUG start codonDepositorInsertnanoLuciferase
Tags3xFLAG and PESTExpressionMammalianPromoterCMVAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - BirA* (AA141-321) - HA - NIPP1
Plasmid#86885PurposeC-terminal part of the split-BioIDDepositorInsertBirA* (AA141-321)- HA- NIPP1]
TagsHA tagExpressionMammalianMutationBirA Amino Acids 141-321Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA flag PPAR gamma E499Q
Plasmid#8896DepositorInsertPPAR gamma (Pparg Mouse)
TagsflagExpressionMammalianMutationE499Q, a mutant in the AF2 domain. Binds PPARg l…Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
p4947 pcDNA4c hBrd4 full-length
Plasmid#14441DepositorAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p190-FLAG
Plasmid#205620PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p190 isoform b3a2
TagsFLAGExpressionMammalianMutationT117M- Please see depositor commentsPromoterCMVAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS Exon Vector
Plasmid#69893PurposeExpression plasmid for expressing circular RNAs of a desired sequence in mammalian cellsDepositorAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 H2B-mIFP T2A Mpro (wt)
Plasmid#163079PurposeExpresses wild type Mpro (active) and a near-infrared fluorescent protein mIFP fused to H2BDepositorInsertWild type Mpro of SARS-CoV-2 and H2B-mIFP
ExpressionMammalianAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-bJun-C-mSOG-IRES-mCherry
Plasmid#136600PurposeEncodes bJun domain tagged with the C-terminal fragment of split-miniSOG (mSOG-Ja95-140).DepositorInsertbJun-C-mSOG
ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-mSOG-bFos-IRES-mCherry
Plasmid#136599PurposeEncodes bFos domain tagged with the N-terminal fragment of split-miniSOG (mSOG1-94).DepositorInsertN-mSOG-bFos
ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry RGS4(del 1-33) in pcDNA3.1
Plasmid#64207PurposemCherry fused between Cry2 and RGS4(del 1-33) to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-FKBP-(GGS)X6-HaloTag C58
Plasmid#171428PurposeExpression of FKBP-(GGS)X6-HaloTag C58 in mammalian cellsDepositorInsertFKBP-(GGS)X6-HaloTag C58
ExpressionMammalianAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 frt/to N-BioTAP-C-BRD4-NUT
Plasmid#171630PurposeExpresses BioTAP-tagged BRD4-NUT in mammalian cells. Can be inserted into a FRT site by co-transfection with a plasmid encoding Flp recombinaase.DepositorAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only