We narrowed to 9,510 results for: control
-
Plasmid#127526PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 13 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 13 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd6
Plasmid#102868PurposeExpresses mouse Fzd6 in mammalian cellsDepositorAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd1
Plasmid#102864PurposeExpresses mouse Fzd1 in mammalian cellsDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-arc105
Plasmid#133425PurposeHuman ARC105 coding sequence in vector for bacterial expression of GST fusion protein.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 1-95 or ARC105 fused to the …Available SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)phiC31
Plasmid#127527PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)Bxb1
Plasmid#127528PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-EglN2 H358A-pBabe-puro
Plasmid#22705DepositorInsertEgg laying Nine - 2 (EglN2) (EGLN2 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationmutated cDNA: point mutation in codon 358 changi…Available SinceDec. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 ShCavin1-EGFP
Plasmid#187253PurposeLentiviral expression of shRNA targeting Cavin1DepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-mFzd3
Plasmid#102865PurposeExpresses mouse Fzd3 in mammalian cellsDepositorAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)4
Plasmid#127522PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 4 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA1
Plasmid#102857PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 kif26b sgRNA2
Plasmid#102858PurposeExpresses sgRNA targeting mouse Kif26bDepositorInsertMouse Kif26b (Kif26b Mouse)
UseLentiviralAvailable SinceDec. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
MBP-rPKL WT
Plasmid#107156PurposeMBP-rPKL WT for production and purification of rat PKL WTDepositorInsertMBP-tagged rat pyruvate kinase liver isoform (Pklr Rat)
TagsC-term 6-his and N-term MBPExpressionBacterialPromoterPBADAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL S113D
Plasmid#107161PurposeFor mammalian expression of Flag-hPKL S113DDepositorInsertFlag-hPKL S113D (PKLR Human)
UseRetroviralTagsN-term FlagExpressionMammalianMutationSerine 113 mutated to aspartatePromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL S113A
Plasmid#107160PurposeFor mammalian expression of Flag-hPKL S113ADepositorInsertFlag-hPKL S113A (PKLR Human)
UseRetroviralTagsN-term FlagExpressionMammalianMutationSerine 113 mutated to alaninePromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiX-(loxPcon-TET-DIAL-YB-TATA)-mCherry-HRasG12V-bGH-EFS-rtTA-TagBFP-WPRE
Plasmid#246367PurposeloxPcon TET-DIAL Reporter Lentivirus with YB_TATA expressing mCherry-HRasG12V in the presence of DOX and rtTA and editable by Cre recombinase. Contains rtTA-TagBFP expressed divergenty.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only