We narrowed to 8,907 results for: Ott
-
Plasmid#47631PurposeAn AAV vector that expresses engineered halorhodopsin 3.0 (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserteNpHR3.0
UseAAV and Cre/LoxTagsiRFPExpressionMammalianPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP
Plasmid#102935PurposeAn AAV vector that expresses rat NK1R-IRES-EGFP under the CMV-IE promoterDepositorAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1442 - pAAV CMV-IE Nuc-iRFP-2A-iCre
Plasmid#112683PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and improved Cre recombinaseDepositorInsertiRFP713
UseAAVTags2A-iCre and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOttc1472 - pAAV CaMKII KDELR1-Myc-DDK
Plasmid#192599PurposeAn AAV packaging vector that expresses KDELR1 under control of the CaMKII promoter.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1012 - pAAV EF1a DIO Nuc-eYFP
Plasmid#75082PurposeAn AAV packaging vector that expresses Cre-dependent nuclear-localized eYFP under control of the EF1a promoter.DepositorInsertNuc-eYFP
UseAAV and Cre/LoxTagsNLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOttc438 - pAAV EF1a CRE ERT2 bGHpA
Plasmid#210415PurposeAAV viral vector packaging plasmid that expresses tamoxifen-regulated Cre recombinaseDepositorInsertCre-ERT2
UseAAVPromoterEF1aAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC351 - pAAV CaMKIIa hChR2(H134R)-iRFP
Plasmid#47905PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) under the CaM Kinase IIa promoter.DepositorInserthChR2(H134R)
UseAAVTagsiRFPExpressionMammalianMutationH134RPromoterCaMKIIaAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1440 - pAAV CMV-IE Nuc-iRFP-2A-Flpo
Plasmid#112684PurposeAn AAV vector that expresses a nuclear-localized iRFP713 reporter and optimized Flp recombinaseDepositorInsertiRFP713
UseAAVTags2A-Flpo and Nuclear localization signalPromoterCMV-IEAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC813 - pAAV-SYN1-CRTsigpep-GCaMP3-KDEL
Plasmid#63886PurposeAn AAV packaging vector that expresses ER-retained GCaMP3 under control of the SYN1 promoter.DepositorInsertER-localized GCaMP3(wt)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
Plasmid#113162PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable markerDepositorInsertSpCas9
TagsFLAGExpressionMammalianMutationD10APromoterCAGAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC809 - pAAV-EF1a-CRTsigpep-GCaMP3-KDEL
Plasmid#63884PurposeAn AAV packaging vector that expresses ER-retained GCaMP3 under control of the EF1a promoter.DepositorInsertER-localized GCaMP3(wt)
UseAAVPromoterEF1aAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1992 - pAAV EF1a CoV2 Orf3a-2xStrep
Plasmid#213542PurposeAAV viral vector packaging plasmid that expresses CoV2DepositorInsertCoV2 Orf3a-2xStrep (ORF3a Severe acute respiratory syndrome coronavirus 2, Human)
UseAAVPromoterEF1aAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1993 - pAAV EF1a CoV2 protE-2xStrep
Plasmid#213543PurposeAAV viral vector packaging plasmid that expresses CoV2DepositorInsertCoV2 protE-2xStrep (E Severe acute respiratory syndrome coronavirus 2, Human)
UseAAVPromoterEF1aAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1663 - pAAV SYN1 mGas6-Myc-DDK
Plasmid#202540PurposeAn adeno-associated viral vector expressing murine Gas6 fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1473 - pAAV CaMKII KDELR2-Myc-DDK
Plasmid#192600PurposeAn AAV packaging vector that expresses KDELR2 under control of the CaMKII promoter.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
Plasmid#113155PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporterDepositorInsertTwo gRNAs for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1388 - pAAV MANF gRNA A+B EF1a EGFP
Plasmid#113157PurposeAn AAV vector that expresses guide RNAs targeting rat MANF and expresses EGFP reporterDepositorInsertTwo gRNAs for rat MANF
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP
Plasmid#112677PurposeAn AAV vector that expresses a Cre-dependent nuclear-localized Red to Green Fluorescent proteinDepositorHas ServiceAAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertNuclear-localized floxed-mCherry EGFP
UseAAVTagsNuclear localization signalPromoterEF1aAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1181 - pmU6(loxP-STOP-loxP) BbsI gRNA
Plasmid#113160PurposeA plasmid for cloning Cre-dependent guide RNAs using a modified mouse U6 promoter containing loxPDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotermU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
Plasmid#47633PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsiRFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1755 - pcDNA3.1 CMV-IE hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201819PurposeA plasmid expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CMV promoterDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
ExpressionMammalianPromoterpOTTC1751Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
Plasmid#113158PurposeAn AAV vector that expresses a Cre-dependent guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1784 - pAAV SYN1 hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201820PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
Plasmid#135565PurposeAn AAV vector expressing miR-30a shRNA vs rat SOM (aka SST) and a nuclear EYFP reporterDepositorInsertsmiR-30 rat SST
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterSYN1 and hSYN1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1618 pAAV SYN1 Nuc-EYFP miR-30 FF3
Plasmid#135564PurposeAn AAV vector expressing miR-30a shRNA vs FF luciferase and a nuclear EYFP reporterDepositorInsertsmiR-30 FF3
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterSYN1 and hSYN1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2185 - pAAV nEF ConFoff hChR2(H134R)-mCherry
Plasmid#202546PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-Off)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2186 - pAAV nEF CoffFon hChR2(H134R)-mCherry
Plasmid#202547PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-Off and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2147 - pAAV nEF ConFon hChR2(H134R)-mCherry
Plasmid#202545PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670
Plasmid#169592PurposeTier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).DepositorInsertphloretin-controlled SEAP and iRFP expression
ExpressionMammalianPromoterTtgO2-PCMVmin-2Available SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
Plasmid#135562PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporterDepositorInsertsshRNA (mouse PKCd)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only