We narrowed to 3,503 results for: cgas
-
-
-
pLG-Nde-Acc
Plasmid#33150DepositorInsertRP51A-synthetic minimal intron (RPS17A Budding Yeast)
TagsLacZExpressionYeastMutationAccI site in intron was cut/filled/ligated to cha…Available SinceDec. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-NT
Plasmid#89960PurposeContains arabinose-induced lambda Red and a tet-inducible non-targeting gRNA containing BsmBI sites for cloning.DepositorInsertempty gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH623
Plasmid#171633Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a non-targeting sgRNA and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-non-targeting
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH029
Plasmid#171060PurposePlasmid for expressing Gag fused to spyCas9-3x FLAG-2x SV40 NLS with the SQNYPIVQ HIV-1 cleavage site in betweenDepositorInsertGag-spyCas9
UseCRISPR and LentiviralTags2x SV40 NLS and 3x FLAG tagExpressionMammalianPromoterCAGAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-mNeonGreen
Plasmid#162034PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsNeon GreenAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT-EF-Pdgfralpha-EGFPN
Plasmid#66787PurposeExpression of murine PDGFRalpha tagged with GFP under the control of EF1a promoterDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWP017
Plasmid#198780PurposeDrives specific expression in the ASI neuronsDepositorInsertPgpa-4-GAL4-SK(DBD)-VP64
ExpressionWormAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT005
Plasmid#171632Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA targeting B2M and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-B2M
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT009
Plasmid#171635PurposePlasmid containing a U6 promoter expressing a spyCas9 sgRNA targeting B2M and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-B2M
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sglacZ: pHR-hU6-CasMINI sgRNA_#2 (sgLacZ); EF1a-Puro-T2A-BFP- WPRE
Plasmid#176272PurposeExpression of non-targeting sgRNA of CasMINIDepositorInsertCasMINI non-targeting sgRNA (sgLacZ) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO mouse shRNA 2 raptor
Plasmid#21340DepositorAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV270
Plasmid#226181PurposeExpresses Cas9 and gRNA targeting KU70 gene in K. phaffii.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-A
Plasmid#177786PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX301-TagRFP
Plasmid#162035PurposeTagged vector controlDepositorTypeEmpty backboneUseLentiviralTagsRFPAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR022
Plasmid#198820PurposeC. elegans optimized version of mScarletDepositorInsert15xUAS::wrmScarlet::let-858 3'UTR
ExpressionWormAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only