We narrowed to 6,927 results for: crispr cas9 plasmids
-
Plasmid#71667PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (DNMT3A Human, Synthetic, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_v2
Plasmid#74407PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR (v2) for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR_v2 (DNMT3A Human, Synthetic, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmiHiFiCas9
Plasmid#164832PurposemiHiFiCas9 expressing plasmidDepositorInsertmiHiFiCas9 (contains Brex27 at sequence 5031-5138).
UseCRISPRTagsFLAG and NLSExpressionMammalianMutationchange R 691 to APromoterCMVAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pS34.EF1α<GFP-2A-Cas9-RC
Plasmid#207404PurposeCas9-RC and GFP from an EF1α promoter. High-performance knockin through DSB repair by homology-directed recombination (HDR) or homology-mediated end joining (HMEJ). [Lab plasmid ID: N213]DepositorInsertCas9-RC
UseCRISPR and Synthetic BiologyTagsGFP-2AExpressionMammalianMutationPromoterEF1αAvailable sinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pScI_dCas9-CDA_J23119-sgRNA
Plasmid#108550PurposeBacterial Target-AID vector with sgRNADepositorInsertsdCas9-PmCDA1
Streptococcus pyogenes sgRNA
UseTagsFlagExpressionBacterialMutationD10A and H840A for SpCas9PromoterJ23119 and lambda ORAvailable sinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC18-mini-Tn7T-Lac-dCas9 (Ptac)
Plasmid#105234PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Ptac promoter for expression in P. putida and P. fluorescensDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599APromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
UseTagsCas9-Venus fusion proteinExpressionMammalianMutationPromoterCAGAvailable sinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas9_nonPuro_OSS
Plasmid#186652PurposeCas9 plasmid to express the Cas9 in OSS cellsDepositorInsertOSS Cas9 Expression Plasmid
UseTagsExpressionInsectMutationPromoterAvailable sinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVhyg
Plasmid#134323PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVneo
Plasmid#134982PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVpuro
Plasmid#134983PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgRNA
Plasmid#124845PurposeVector for FLP-dependent expression of SaCas9 with gRNADepositorInsertSauCas9 gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc18a2
Plasmid#124849PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc18a2
Plasmid#124862PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-dSaCas9-KRAB-bGHpA
Plasmid#106219PurposeAAV expressing deactivated S. aureus Cas9 fused to a KRAB repressorDepositorInsertdead S. aureus Cas9 KRAB
UseAAV and CRISPRTagsHA-NLSExpressionMammalianMutationD10A and N580APromoterCMVAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdR
Plasmid#80940PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only