We narrowed to 9,829 results for: CAG
-
Plasmid#153017PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable sinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-malG
Plasmid#89951PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting malG.DepositorInsertmalG gRNA
ExpressionBacterialPromoterpTetAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pADH100-2
Plasmid#90981PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH99 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, FRT, DS_HIS1
UseCRISPRAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable sinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EPN-11 (1wa3)
Plasmid#80122PurposePalm1-Late1-I3-01-myc (1wa3)DepositorInsertEPN-11 (1wa3)
ExpressionBacterial and MammalianAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorPublicationInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pegRNA_LMNA_CR-2-5
Plasmid#199275PurposepegRNA used to correct LMNA (c.1824C > T) mutationDepositorInsertLMNA 1824TtoC pegRNA
ExpressionMammalianAvailable sinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
SETMAR-Cas9
Plasmid#186701PurposePlasmid encoding SETMAR-Cas9 fusion under CMV promoterDepositorInsertSETMAR-Cas9
UseCRISPRTagsFLAGExpressionMammalianPromoterCMVAvailable sinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_MBD1_iso1_2
Plasmid#86304PurposeEncodes gRNA for 3' target of human MBD1_iso1DepositorPublicationInsertgRNA against MBD1_iso1 (MBD1 Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZO-1 shRNA 2968
Plasmid#37208DepositorAvailable sinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR CRY2-TSS-guide1
Plasmid#125428PurposeCRISPR-mediated repression of CRY2. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMef2c-AHF-DEST (JDW 476)
Plasmid#242577PurposeGateway destination vector with the murine Mef2c anterior heart field promoter in the backbone.DepositorTypeEmpty backboneExpressionMammalianAvailable sinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiCh2-2
Plasmid#202444PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertChromosome 2 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TFORF0511
Plasmid#143037PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0207
Plasmid#141555PurposeLentiviral vector for overexpressing the FOXP2 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pv6_MECP2_MBD
Plasmid#179407PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of MECP2_MBDDepositorAvailable sinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only