We narrowed to 20,115 results for: IRE;
-
Plasmid#184337PurposeExpression of V5-tagged mouse FAM19A1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only
-
-
XE158 GFP-delta LZ-XDpr-CS2+
Plasmid#16764DepositorInsertdelta LZ-XDpr (dact1-b Frog)
UseXenopus expressionTagsgfpMutationXDpr is truncated to delete the first 129 amino a…Available SinceMarch 13, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRRG43-sFRP1
Plasmid#99071PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea sFRP1 (secreted frizzled related protein 1)DepositorInsertsFRP1 (secreted frizzled related protein 1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceSept. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWL502-PAM
Plasmid#174382PurposePlasmids bearing protospacer sequences with functional PAM efficiently triggered CRISPR-mediated defense in cells with corresponding spacer sequence; article demonstrates use in Haloferax mediterraneiDepositorInsertPAM-spacer
UseCRISPR; Archaeal expressionExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG5-Myr-FLAG-p110β-DM
Plasmid#55719Purposeeukaryotic expression of myristoylation tag (Myr-FLAG) p110b RBD double mutant S205D, K224ADepositorInsertp110 beta
Tagsmyristoylation tag (Myr-FLAG)ExpressionMammalianMutationS205D, K224APromoterT7Available SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH3409
Plasmid#179574PurposePceh-12::tomm20::miniSOG-SL2::RFP unc-54 3' UTR C.elegans VB-MN -specific expression of miniSOG-SL2 RFPDepositorAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
TagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
MPC11 IgG2b gene
Plasmid#127248PurposeExpresses intact IgG2b gene in mammalian cellsDepositorInsertIgG2b gene with exons and alt pAs (Ighg2b Mouse)
ExpressionMammalianAvailable SinceAug. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-2
Plasmid#172739PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-2; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-2
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB1a2R+pNOS_Red-F_NOSt
Plasmid#170888PurposeGoldenBraid Transcriptional Unit - pNOS_Red-F_NOSt Reverse orientationDepositorInsertRed-F
UseLuciferase and Synthetic BiologyExpressionPlantMutationp.S286Y Red mutantPromoterpNOSAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Sema4c-ISH-2kb
Plasmid#68031PurposeContains 2kb cDNA fragment for probe synthesis for mRNA in situ hybridization, species: mouseDepositorInsertSemaphorin-4C (Sema4c Mouse)
UseMrna in situ hybridization probeAvailable SinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
ERAS
Plasmid#55656Purposeexpression of mouse ERASDepositorAvailable SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
GEM
Plasmid#55680Purposeexpression of mouse GEMDepositorAvailable SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
Plasmid#169370PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0303_Cq-U6-6_2xBbsI_gRNA-Loop
UseCRISPRExpressionInsectPromoterCPIJ039596Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGREAT4
Plasmid#170892PurposeGoldenBraid Double Transcriptional Unit - pG10-90_E-Luc_NOSt+pNOS_Red-F_NOStDepositorInsertE-Luc
UseLuciferase and Synthetic BiologyExpressionPlantMutationc.375C>T silent mutation to remove BbsI site (…PromoterpG10-90Available SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
fgfprom luc
Plasmid#69446Purposebasal plasmid containing minimal fgf4 promoter used for testing enhancer activity of DNAs inserted immediately upstream of the promoter.DepositorInsertminimal fgf4 promoter
UseLuciferaseExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-GW1D1a(aa254-503)
Plasmid#21520DepositorAvailable SinceSept. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
CMV-CC2
Plasmid#51221Purposeexpression of amino acid 917-1040 of chicken DCTN1 p150Glued in mammalian cellsDepositorAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_2
Plasmid#106315PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorInsertsgRNA targeting mShmt2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Sema4d-ISH-2kb
Plasmid#68032PurposeContains 2kb cDNA fragment for probe synthesis for mRNA in situ hybridization, species: mouseDepositorInsertSemaphorin-4D (Sema4d Mouse)
UseMrna in situ hybridization probeAvailable SinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Plxnb1-ISH-2kb
Plasmid#68035PurposeContains 2kb cDNA fragment for probe synthesis for mRNA in situ hybridization, species: mouseDepositorInsertPlexin-B1 (Plxnb1 Mouse)
UseMrna in situ hybridization probeAvailable SinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pr2-deGFP-MGapt
Plasmid#67736PurposeOR2-OR1-Pr2 promoter expressing deGFP-MG aptamer fusionDepositorInsertUTR1-deGFP-MGapt-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr2Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pr1-deGFP-MGapt
Plasmid#67735PurposeOR2-OR1-Pr1 promoter expressing deGFP-MG aptamer fusionDepositorInsertUTR1-deGFP-MGapt-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-Pr1Available SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLPC myc-mRAP1 I312R
Plasmid#73137PurposeExpression of myc-tagged mRAP1 with single point mutatoin I312RDepositorInsertRap1 (Terf2ip Mouse)
TagsmycExpressionMammalianMutationisoleucine changed to an arginine at amino acid 3…Available SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRRG45-GluR1
Plasmid#99070PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea GluR1 (Glutamate receptor 1)DepositorInsertGluR1 (Glutamate receptor 1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-TTF-1-Q50K-Y54M
Plasmid#75264PurposeExpresses a double point mutant of human TTF-1DepositorInsertTTF-1 (NKX2-1 Human)
TagsnoneExpressionMammalianMutationQ50K and Y54M in the homeodomainAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only