We narrowed to 7,236 results for: mag
-
Plasmid#197506PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HiFi(D10A/R69…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-N-Cadherin-2xHA
Plasmid#196896PurposeNeuron-specific expression of N-Cadherin fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ARAP3(R307,8A)
Plasmid#39486DepositorInsertARAP3(R307,8A) (ARAP3 Human)
TagsEGFPExpressionMammalianMutationR307,8A = PH domain mutationAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HF1-P2A-EGFP (LM422)
Plasmid#197505PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HF1(D10A/N497…PromoterCMV and T7Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ARAP3(C504A)
Plasmid#39485DepositorInsertARAP3(C504A) (ARAP3 Human)
TagsEGFPExpressionMammalianMutationC504A = Arf GAP domain mutationAvailable SinceAug. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II donor only control (FL-based tension sensor)
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi sgNF2-1
Plasmid#253094PurposeCRISPRi single-guide against NF2DepositorInsertNF2 (NF2 Human)
UseCRISPRAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5
Plasmid#246743PurposeBacterial expression of human DNAJC5 wildtype with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialPromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 L115R
Plasmid#246745PurposeBacterial expression of human DNAJC5 L115R with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationL115RPromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 L115R
Plasmid#246742PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 delL116
Plasmid#246741PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 delL116
Plasmid#246744PurposeBacterial expression of human DNAJC5 L116 deleted with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationdelL116PromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway CloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-B-catenin-S33Y-FLAG (JDW 419)
Plasmid#242565PurposeGateway middle entry clone containing dominant active B-catenin (S33Y beta catenin)DepositorInsertS33Y B-catenin (CTNNB1 Human)
UseGateway CloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only