We narrowed to 18,122 results for: URE
-
Plasmid#109658PurposeMuscle specific zebrafish expression of mKate2 fused to rab8bDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only
-
actc1b-mKate2-rab1ab
Plasmid#109606PurposeMuscle specific zebrafish expression of mKate2 fused to rab1abDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NCK1-2/3
Plasmid#91420PurposeProtein expression and purification of human SH3 domain construct NCK1-2/3DepositorInsertNCK1-2/3 (NCK1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
UKNP6.1.2
Plasmid#98388PurposeExpression of HCV E1E2 genes cloned from patient serum. United Kingdom Nottingham Panel x.xx.xx (genotype.patient number.clone number)DepositorInsertHCV E1E2
ExpressionMammalianAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 CTTN
Plasmid#67100PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p3E-FAPP1
Plasmid#109555PurposeMultisite gateway vector for 3' tagging with the PH domain from Human pleckstrin homology domain containing A3 (PLEKHA3). Binds PtdIns4PDepositorInsertthe PH domain from Human pleckstrin homology domain containing A3 (PLEKHA3).
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
actc1b-BTK-mKate2
Plasmid#109501PurposeMuscle specific zebrafish expression of mKate2 fused to the PH domain from Human Bruton tyrosine kinase (BTK). Binds PtdIns(3,4,5)P3.DepositorInsertactc1b-BTK-mKate2
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_C1 I3
Plasmid#61397PurposeExpresses GFP-tagged Inhibitor-3 in mammalian cellsDepositorAvailable SinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
UKNP2.2.1
Plasmid#98209PurposeExpression of HCV E1E2 genes cloned from patient serum. United Kingdom Nottingham Panel x.xx.xx (genotype.patient number.clone number)DepositorInsertHCV E1E2
ExpressionMammalianAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
CALNL-DCX-eGFP
Plasmid#28310DepositorAvailable SinceApril 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTS2353_Tier3(PB)-YPet_PuroR
Plasmid#169652PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA_GFP_mTLN1-FL-LBD
Plasmid#164839PurposeExpression of GFP tagged FL mouse talin1 mutantDepositorInsertTLN1 (Tln1 Mouse)
TagsHis8-GFPExpressionMammalianMutationLipid binding deficient mutationsAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-CmTMC1truncated
Plasmid#154908PurposeFor the expression and purification of the truncated TMC1 protein from Chelonia mydas. The protease cleavage site was replaced with the HRV 3C site.DepositorInsertGFP-CmTMC1truncated
Tags8histidine-EGFPExpressionInsectMutationTruncations of the residues 1-243 and 843-969Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-MuTMC2truncated
Plasmid#154909PurposeFor the expression and purification of the truncated TMC2 protein from Melopsittacus undulates. The protease cleavage site was replaced with the HRV 3C site.DepositorInsertGFP-MuTMC2truncated
Tags8histidine-EGFPExpressionInsectMutationTruncations of the residues 1-179 and 691-716Available SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
FnoCas12a-DR-cr in PBCSK-
Plasmid#126642PurposeCloning vector FnoCas12a DR-crRNA for expression in mammalian cellsDepositorInsertFnoCas12a Full Length Direct Repeat crRNA
UseCRISPRExpressionMammalianPromoterU6 PromoterAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_UBASH3A-1/1
Plasmid#91478PurposeProtein expression and purification of human SH3 domain construct UBASH3A-1/1DepositorInsertUBASH3A-1/1 (UBASH3A Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
UKNP2.5.1
Plasmid#98213PurposeExpression of HCV E1E2 genes cloned from patient serum. United Kingdom Nottingham Panel x.xx.xx (genotype.patient number.clone number)DepositorInsertHCV E1E2
ExpressionMammalianAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)(2) sites mutant pGL3Basic
Plasmid#32734DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) - CTTTGATCTTTGCT deleti…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pME-APEX2-mCherry
Plasmid#188944PurposeMiddle entry vector for Gateway cloning containing APEX2 tagged to mitochondria and nuclei, and cytoplasmic mCherryDepositorInsertmito-APEX2_p2A_APEX2-H2B_p2A_mCherry
UseMiddle entry vector for gateway (l1-l2)Available SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
actc1b-mKate2-EHD1b
Plasmid#109514PurposeMuscle specific zebrafish expression of mKate2 fused to EHD1bDepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Control-E2F-3'UTR-Mut
Plasmid#21171DepositorInsertE2F 3'UTR Mutant (E2F1 Human)
UseLuciferaseExpressionMammalianMutation2 miR binding sites mutated. Changed from GCACTTT…Available SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTS2381-Tier1-PhCMV-Igk_TM
Plasmid#169487PurposeTier-1 vector encoding PhCMV-driven transmembrane domain from Junctophilin-1 (TM) for membrane localization of fusion proteins attached to a secretion signal Igk (PhCMV-IgkSS-TM-pA).DepositorInsertPCMV-driven membrane localization
ExpressionMammalianPromoterPhCMVAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 FYN
Plasmid#67106PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-TO-myc-His Trask [YdeltaF] mutant
Plasmid#31769DepositorInsertTrask (CDCP1 Human)
TagsHis and MycExpressionMammalianMutationY707/734/743FPromoterCMVAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-CDS
Plasmid#136053PurposeREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVH615
Plasmid#169604PurposeTier-2 vector encoding PCREm4-driven Nluc and PmPGK1-driven Fluc expression (A1-pA::PCREm4-Nluc-pA::PmPGK1-Fluc-pA).DepositorInsertPPGK-driven FLuc Luciferase expression cassette and cAMP response element-controlled NanoLuc Luciferase expression cassette
ExpressionMammalianPromoterPCREm4 / PPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NCK1-3/3
Plasmid#91476PurposeProtein expression and purification of human SH3 domain construct NCK1-3/3DepositorInsertNCK1-3/3 (NCK1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Mac-GFP
Plasmid#58849PurposeAAV expression of Mac-GFP under the CaMKII promoterDepositorInsertMac-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAN1735
Plasmid#127204PurposeDual inducible expression of SynTF-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertpGal1-SynTF-mScarlet-degronSwitch_A_t12-tSSA1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tENO1
UseSynthetic BiologyAvailable SinceJune 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 CREBZF
Plasmid#67070PurposeStandard for cell-free expression benchmarking.DepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only