We narrowed to 10,263 results for: ada
-
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-CyOFP1
Plasmid#105799PurposeExpression of your protein of interest in fusion with orange fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 27240196). CyOFP1 is useful for multi-channel imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-CyOFP1ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ufd1-Strep-HA
Plasmid#113474PurposeExpression of human Ufd1 with C-terminal strep-HA tagDepositorInsertUfd1 (UFD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-miRFP670nano3-Blast-H3C2
Plasmid#207784PurposeDonor template for miRFP670nano3-2A-Blast insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a miRFP670nano3-Blast Cassette (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDisplay-GRAB_CRFmut
Plasmid#208656PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut in mammalian cellsDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut
ExpressionMammalianPromoterCMVAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFos-XRI-V5
Plasmid#178058PurposeExpression Recording Islands (XRIs) for recording cellular physiological histories along intracellular protein self-assembly. Contains XRI subunit with V5 tag, under c-fos promoter.DepositorInsertXRI-V5
UseAAVTagsV5-MBPExpressionMammalianPromoterMouse c-fos promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-L398T-WPRE-SV40
Plasmid#101064PurposeAAV vector expressing CaMPARI2_L398T (Kd = 825nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2_L398T
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
aav-tnt-wtmrtfa-gfp
Plasmid#165037PurposeAAV-based delivery of wtMRTFA-GFP into cardiomyocytes in vivoDepositorAvailable SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IRES-puro-3xFLAG-NBR1
Plasmid#204546PurposeExpresses 3xFLAG-tagged NBR1 in mammalian cellsDepositorAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
hCGNL1-Myc-HA
Plasmid#236515PurposeFor expression of hParacingulinL1 in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pD40-His/V5-c-Myc
Plasmid#45597DepositorAvailable SinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
NOTCH3-bio-His
Plasmid#53343PurposeExpresses full-length Neurogenic locus notch homolog protein 3 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertNOTCH3 (NOTCH3 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-MAPRE1
Plasmid#227324PurposeDonor template for mStayGold insertion into the C-terminus of the MAPRE1 locus. For growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 (Addgene #207793)DepositorInsertMAPRE1 Homology Arms flanking a mStayGold Tag (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-G395D-WPRE-SV40
Plasmid#101063PurposeAAV vector expressing CaMPARI2_F391W-G395D (Kd = 530nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertCaMPARI2_F391W-G395D
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
Integrin beta5-2XEGFP
Plasmid#139779PurposeDetecting Integrin beta5 by fluorescence microscopyDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-TAF4B
Plasmid#192927PurposeBarcoded piggybac transposon vector with Dox-inducible expression of TAF4BDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXJ42-p200 CUX1
Plasmid#100813PurposePlasmid vector expressing human p200 CUX1 (amino acids 1-1505 of P39880), with an N-terminal Myc tag and a C-terminal HA tagDepositorInsertp200 CUX1 (CUX1 Human)
UseNote that this plasmid does not have an sv40 oriTagsHA and MycExpressionMammalianAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-OCT4
Plasmid#130692PurposeLentiviral plasmids encoding human OCT4 (POU5f1) along with GFP linked via P2A.DepositorInserthuman OCT4 (POU5F1 Human)
UseLentiviralAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only